ID: 1093436425

View in Genome Browser
Species Human (GRCh38)
Location 12:19140018-19140040
Sequence TAATTGGAAGACCTTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093436425 Original CRISPR TAATTGGAAGACCTTGCCAC TGG (reversed) Intronic
901984794 1:13066607-13066629 CAATCGAAAGACCTTCCCACAGG + Intronic
901997016 1:13160163-13160185 CAATCGAAAGACCTTCCCACAGG - Intergenic
903206277 1:21784692-21784714 TGAAAGGAAGACCTTGCCGCCGG + Intergenic
904537429 1:31209041-31209063 TAACAGGAAGACCATCCCACTGG + Intronic
904973444 1:34436775-34436797 TAGTTGAAAGACATTCCCACAGG + Intergenic
906247969 1:44290364-44290386 CAGTTGGAAGATCCTGCCACAGG + Intronic
909996379 1:82285299-82285321 TAATTGGAATACCTTTGCAGGGG + Intergenic
912623250 1:111187069-111187091 CAAGTGGAAGACCTGGCCATGGG - Intergenic
914169878 1:145214466-145214488 TGTTTCGAAGACCATGCCACAGG - Intergenic
924662622 1:246035547-246035569 TAATTGGAACATCTTGTCACAGG + Intronic
924872042 1:248058219-248058241 TAATTTGAAGTCCTTGCCTTTGG - Intronic
1068766698 10:60772207-60772229 TAATTGAAAGAACTTTCCACAGG - Intergenic
1070501199 10:77073947-77073969 TAATTGGATGAGCATGCCTCTGG - Intronic
1076415219 10:130281873-130281895 TATTTGGAACATCTTGTCACAGG - Intergenic
1079394162 11:20047536-20047558 TAATTGGAAGTGCTTGGCAATGG + Intronic
1079768092 11:24419827-24419849 TAAGTTGAAGACCTTGGCATGGG - Intergenic
1081901930 11:46636166-46636188 TTATTGGAATACGATGCCACAGG - Intronic
1084147638 11:67273524-67273546 AGGTTGGAAGAACTTGCCACTGG - Intronic
1087349214 11:97009910-97009932 TCTTTGGAATACCTTGCCATAGG + Intergenic
1092564658 12:9651409-9651431 TAATTGGCTGACCATTCCACAGG + Intergenic
1092804451 12:12206868-12206890 CTATTGGAAGACCTGGCCTCAGG - Intronic
1093436425 12:19140018-19140040 TAATTGGAAGACCTTGCCACTGG - Intronic
1094637712 12:32242670-32242692 TAAGTGGAAATCCTTTCCACTGG + Intronic
1095892945 12:47251329-47251351 TAATTTGAAGAACTTGTCATTGG - Intergenic
1106384555 13:29271205-29271227 TAATTAGAAGAAGTTGCCAATGG - Intronic
1109692615 13:65912697-65912719 AAACAGGAAGACCTTGCCACTGG + Intergenic
1111517737 13:89357260-89357282 TAATTGAAAGAACTTGGCAAAGG + Intergenic
1111904940 13:94244316-94244338 CAATAGGAAGACATTGTCACTGG + Intronic
1112685837 13:101825152-101825174 TAATTGGAAGTCCTGGCCTCTGG - Intronic
1113005777 13:105700271-105700293 TAATGGGAACACCTGGACACAGG - Intergenic
1114450032 14:22819453-22819475 TTAATGGAAGCCCTGGCCACAGG - Intronic
1120844496 14:89114129-89114151 TAAGTGGCAGAAGTTGCCACAGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1130860641 15:87885114-87885136 TATTTTGAAGTCATTGCCACCGG - Intronic
1131128556 15:89878138-89878160 TCGTTAGAAGATCTTGCCACTGG + Intronic
1140838147 16:78814677-78814699 TGATTGGAAAACCTTGACCCTGG - Intronic
1142360303 16:89623028-89623050 CAATTGGAAGAACTGGCCCCAGG + Intronic
1144400529 17:14894618-14894640 TAATTTGAAGACATTTTCACAGG + Intergenic
1146380243 17:32322595-32322617 TAGTTGGAAAACTTTGCCTCAGG + Exonic
1164024790 19:21341977-21341999 TCATTGGAAAGCGTTGCCACAGG - Intergenic
1165450143 19:35877753-35877775 GAATTGGAAGCCCCTGCCCCTGG + Exonic
1168342401 19:55632744-55632766 TACTTAAAAGACCTTTCCACTGG - Intergenic
928066327 2:28168114-28168136 TAGTTGGAAGTGCTTTCCACTGG - Intronic
935049896 2:99516383-99516405 TAATTGCAAGATGTTGCCATTGG - Intergenic
936550189 2:113431105-113431127 TAATTGAAATACCATGCTACTGG - Intergenic
937094367 2:119225821-119225843 TATTTGCAAAACCTTGCCAAGGG + Intronic
938963336 2:136362501-136362523 TAATTAGATGACCTTGACATAGG - Intergenic
940618556 2:156082866-156082888 TAATTTGAAGACCTTGTCTTTGG + Intergenic
943891165 2:193289299-193289321 TAATTTGAAGACTTTGCCTTCGG + Intergenic
948677026 2:239602770-239602792 TAACAGGAAGACCTTGTCCCAGG - Intergenic
948677059 2:239602906-239602928 TAACAGGAAGACCTTGTCCCAGG - Intergenic
948750655 2:240130598-240130620 CACTTGGAGGACCTTGCCACGGG - Intronic
1172533888 20:35655286-35655308 CAATTGGGAGACCTTGCAAACGG + Exonic
1173456418 20:43205945-43205967 TAATTGTTAAACCTTGGCACCGG + Intergenic
1174119269 20:48250065-48250087 TATTTGGAAGACCATGACAATGG + Intergenic
1178791744 21:35706499-35706521 TAATTGAAAGAACTTGGCAAAGG - Intronic
951942696 3:28097908-28097930 TAGTTGGAACACCTGGACACAGG - Intergenic
953867389 3:46596089-46596111 TAATTGGAAGTCTGTGCCACTGG - Intronic
954865031 3:53721431-53721453 CAATTGGCTGACCTTTCCACGGG + Intronic
959409433 3:106001875-106001897 AAAGTGGAAGACTTTGCAACTGG + Intergenic
970726522 4:19051909-19051931 TGATTGAAAAACCTTGCCCCAGG - Intergenic
976011708 4:80496761-80496783 TAATTGGCATACCATTCCACAGG + Intronic
978683393 4:111410799-111410821 TATTTGGAAGTCCTAGCCACAGG - Intergenic
979428144 4:120593609-120593631 TAATTGGCTGACGTTCCCACAGG + Intergenic
979836249 4:125371598-125371620 TAATTTCTAGACCTTGCCTCAGG + Intronic
983393550 4:167164635-167164657 TAATGGGAAGACATGGACACAGG - Intronic
983421220 4:167520010-167520032 TATTTGGAAGAGTTTCCCACAGG + Intergenic
984125113 4:175798964-175798986 CAATTGGAAATCCTTGCCAGAGG + Intronic
984258477 4:177415264-177415286 TTATTTGAAGAAATTGCCACAGG - Intergenic
984950355 4:185003388-185003410 GGATTGGAAGAGCTTGCTACTGG - Intergenic
987700025 5:21385663-21385685 CAATTGGAAGACCTTACAATAGG + Intergenic
988752382 5:34202426-34202448 CAATTGGAAGACCTTACAATAGG - Intergenic
989582967 5:43050669-43050691 TATTTGGAGGACCTTGACAAGGG + Intergenic
990425205 5:55681512-55681534 TCTTTGGATGACCTTGCCAAAGG + Intronic
991121958 5:63027094-63027116 TAATTGGAAAACAGTGGCACAGG - Intergenic
991740149 5:69663253-69663275 CAATTGGAAGACCTTACAATAGG - Intergenic
991757350 5:69889935-69889957 CAATTGGAAGACCTTACAATAGG + Intergenic
991791724 5:70242994-70243016 CAATTGGAAGACCTTACAATAGG - Intergenic
991819612 5:70539370-70539392 CAATTGGAAGACCTTACAATAGG - Intergenic
991836753 5:70765817-70765839 CAATTGGAAGACCTTACAATAGG + Intergenic
991884173 5:71243332-71243354 CAATTGGAAGACCTTACAATAGG - Intergenic
992203689 5:74409343-74409365 TAATTGGAAGACCTGGCTGCCGG - Intergenic
992835877 5:80640947-80640969 GAATCGGAGGACCCTGCCACAGG - Intronic
993411791 5:87583107-87583129 TAACTGGAAGAACTTGGCAGGGG + Intergenic
994476251 5:100274001-100274023 TAATTTTAAGAAATTGCCACAGG + Intergenic
995057344 5:107775108-107775130 TATTTTGAAGACCCTTCCACAGG + Intergenic
995131069 5:108631088-108631110 TAATAGGAAGACCTTGGGAAAGG - Intergenic
999499184 5:152129747-152129769 TAATTGGTAGTTCCTGCCACAGG - Intergenic
999511801 5:152259978-152260000 CATGTGGAAGCCCTTGCCACTGG + Intergenic
1001334832 5:170788531-170788553 TAAGTGGAAGGCCGTGCAACAGG - Intronic
1005550551 6:26909150-26909172 CAATTGGAAGACCTTACAATAGG - Intergenic
1011203343 6:84862758-84862780 TAACTGGAACACCTGTCCACTGG - Intergenic
1013835849 6:114334263-114334285 GAATTGGAAAAGCTTGCCACGGG - Intronic
1015185996 6:130416547-130416569 GAATACGAAGACCTTGACACTGG - Intronic
1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG + Intronic
1022673184 7:32475144-32475166 AAATTGGAACAGCTTGCCTCAGG - Intergenic
1024109018 7:46126293-46126315 TAGTAGGAAGACCTTGGCATAGG + Intergenic
1028094247 7:86740762-86740784 GAGTTGGAAGTCCTTGCCAAGGG - Intronic
1033363421 7:140653857-140653879 TAATTGGAAGATGTTGGCAGGGG + Intronic
1039101137 8:33943208-33943230 TAAATGGAAGACCTGGGAACAGG + Intergenic
1041539437 8:58966521-58966543 TGCTTGGAAGACTTGGCCACGGG + Intronic
1043069034 8:75615183-75615205 TAATTGGAAGCCCATGGAACAGG - Intergenic
1044662907 8:94609016-94609038 TAATTTGAAGATGTTGCCATTGG + Intergenic
1052223955 9:26061338-26061360 TAATTTGAAGGCCTTTACACTGG - Intergenic
1052591054 9:30496041-30496063 TAAATTGAAGACCTTTCCACCGG + Intergenic
1052918362 9:33941728-33941750 TAAGAGGAAGACATTGCTACTGG + Exonic
1053470109 9:38340263-38340285 TTATTGGAAGGCCATGCCAGGGG - Intergenic
1053745773 9:41195999-41196021 TAATTGAAATACCATGCTACTGG + Intronic
1054481497 9:65669217-65669239 TAATTGAAATACCATGCTACTGG - Intronic
1054682570 9:68235274-68235296 TAATTGAAATACCATGCTACTGG - Intronic
1056873145 9:90303884-90303906 TACTTGAAAGACCTTGGCACGGG - Intergenic
1062430220 9:136523584-136523606 TAATTGGGAGCCCCTGCCCCAGG - Intronic
1202781905 9_KI270718v1_random:6778-6800 TAATTGAAATACCATGCTACTGG + Intergenic
1187434784 X:19257639-19257661 TCCTTGGAAGAACTGGCCACAGG + Intergenic
1189512391 X:41676091-41676113 TACTTGGCAGAGGTTGCCACTGG - Intronic
1189867817 X:45349884-45349906 TAATTTGAAGACCTTTCTACAGG + Intergenic
1190486731 X:50934181-50934203 TTATTGTAAGAAATTGCCACAGG + Intergenic
1190972421 X:55364183-55364205 TATTTGGAAGAACTTGCAAGAGG + Intergenic
1193635064 X:83939984-83940006 TTATTGGAAGACCTGGCCAGAGG - Intergenic
1198834083 X:140783189-140783211 TTGTTGGAAGACCTTGACACAGG - Exonic
1199535837 X:148902254-148902276 TGATAGGATGAGCTTGCCACTGG - Intronic
1199948600 X:152687396-152687418 TAAATGGAAGTCCTGGTCACTGG + Intergenic
1199961078 X:152781053-152781075 TAAATGGAAGTCCTGGTCACTGG - Intergenic