ID: 1093436870

View in Genome Browser
Species Human (GRCh38)
Location 12:19145643-19145665
Sequence ACTCCTGTTGTTGGACATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093436870 Original CRISPR ACTCCTGTTGTTGGACATCG AGG Intronic
902161344 1:14532863-14532885 TGTCCTGTTGTTGGACATTTGGG + Intergenic
902167504 1:14584258-14584280 TCTCCGGTTGTTGGACAACTGGG - Intergenic
902195077 1:14792325-14792347 ACATCTGTTGTTGGACATTTGGG - Intronic
907216107 1:52865563-52865585 TCGCCTGTTGTTGGACATTTGGG - Intronic
907950939 1:59182999-59183021 TCTACTGTTGATGGACATCTGGG - Intergenic
910382477 1:86643543-86643565 TCTCCTGTTGTTGGACAGTTGGG + Intergenic
912913593 1:113788949-113788971 TCTCCTATTCTTGGACATTGAGG - Intronic
913309565 1:117475068-117475090 TCTCCTGTTGATGGACATTTAGG + Intronic
1064927475 10:20585061-20585083 TCTCCTGTCGTTGCAGATCGGGG + Intergenic
1064930946 10:20625822-20625844 ACTCCTATTGTTGGACAAATTGG + Intergenic
1065005685 10:21377982-21378004 TCCCCTTTTGTTGGACATCTAGG - Intergenic
1065629788 10:27666922-27666944 CCTCCTGTTGATGGACATGTGGG - Intergenic
1065722295 10:28638615-28638637 CCACCTGTTGTTAGACATCAAGG + Intergenic
1066658717 10:37719763-37719785 ACACCTGTGATTGGACATTGAGG - Intergenic
1069684829 10:70311183-70311205 GTTCTTGTTGTTGGACATCCAGG + Intronic
1069883021 10:71605761-71605783 TCCCCTATTGTTGGACATCTAGG + Intronic
1071758210 10:88570107-88570129 TCTCCAGTTGTTGGACATGGAGG - Intronic
1071934461 10:90512382-90512404 TCTCCTGTTGATGGACATCTGGG - Intergenic
1073174776 10:101548323-101548345 TCTCTTGTTGGTGGACATAGGGG - Intronic
1073423077 10:103440062-103440084 GCTCCTGTTGTTGGGGATGGTGG + Intronic
1074179757 10:111048863-111048885 TCTACTGTTGTTGGACATTTGGG - Intergenic
1076022535 10:127085885-127085907 AGTCCAGTTGTGGGACATTGTGG + Intronic
1080440141 11:32286356-32286378 TCTACTGTTGATGGACATCTAGG - Intergenic
1081290301 11:41316941-41316963 ACTCCTGTTGTGTGACCTTGTGG + Intronic
1081753127 11:45526281-45526303 TCCCCTGTTGTTGGACATTTAGG + Intergenic
1083973263 11:66096438-66096460 TCTCCTGTTGATGGACATATAGG + Intronic
1085169243 11:74434374-74434396 TCTTCTGTTGATGGACATCTGGG - Intergenic
1085230726 11:74967460-74967482 TCTTCTGTTGCTGGGCATCGTGG + Intronic
1086985058 11:93238545-93238567 TCTCCTGTTGATGGACATTTAGG + Intergenic
1087483497 11:98732207-98732229 ACTCCTGTTGTTGGTCAGGCTGG + Intergenic
1088705834 11:112463968-112463990 TCATCTGTTGTTGGACATCTGGG + Intergenic
1090218815 11:124997120-124997142 TCTCCTATTGATGGACATCTGGG + Intronic
1091751096 12:3021666-3021688 ACTCCTTTTGTTTTACATCCTGG - Intronic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1095413611 12:41950687-41950709 TTTCCTGTTGATGGACATCTGGG - Intergenic
1095563874 12:43597566-43597588 TCTACTGTTGATGGACATTGAGG + Intergenic
1097131761 12:56816439-56816461 AATCCTGTTGTTTGACCTCATGG + Intergenic
1098382626 12:69884662-69884684 ACTCCTGTTGTTGGCCTCCATGG - Intronic
1100208015 12:92372344-92372366 ACTCCTGTTGATGGACATTTGGG + Intergenic
1101877424 12:108605092-108605114 TCTCCTGTTGATGGACATTTGGG - Intergenic
1101926842 12:108978865-108978887 ACTCCTGTTGATGGACATTCTGG - Intronic
1102549467 12:113681017-113681039 TGTCCTGTTGCTGGACATCTGGG - Intergenic
1103965351 12:124635594-124635616 TCTCCTGTTGATAGACATCTGGG + Intergenic
1105435084 13:20369803-20369825 TCACCTGTTGATGGACATCTGGG - Intergenic
1106562515 13:30859002-30859024 ACTCCTGTTATTGCACCTCTAGG - Intergenic
1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG + Intronic
1115930974 14:38494172-38494194 TCACCTGTTGTTGGACATTTAGG + Intergenic
1116289642 14:43017134-43017156 ACTATTGTTGTTGGACATTTAGG - Intergenic
1119223706 14:72928517-72928539 TCCCCTGTTGTTGGATATCTAGG + Intronic
1121445994 14:93979478-93979500 TCTACTGTTGATGGACATCTGGG + Intergenic
1121806366 14:96828151-96828173 TTTCCTGTTGTTGGACATACAGG + Intronic
1121936807 14:98027413-98027435 ACACCAGTTGTGGGAGATCGTGG + Intergenic
1123652536 15:22488593-22488615 TCTCCTGTTGATGGACATTTAGG + Intergenic
1123742958 15:23297452-23297474 TCTCCTGTTGATGGACATTTAGG + Intergenic
1124276302 15:28328423-28328445 TCTCCTGTTGATGGACATTTAGG - Intergenic
1124306396 15:28583184-28583206 TCTCCTGTTGATGGACATTTAGG + Intergenic
1125253107 15:37729291-37729313 TCACCTGTTATTGGACATCTAGG + Intergenic
1126502512 15:49361638-49361660 AGTCCTGTTGATGGGCATCTAGG + Intronic
1128204674 15:65840169-65840191 TCTCCTGTTGTTGGCCATTTCGG + Intronic
1130196737 15:81786473-81786495 TCTACTGTTGATGGACATCTGGG + Intergenic
1133401602 16:5491497-5491519 TCTCCTGTTGATGGACATTTGGG - Intergenic
1136689277 16:32016983-32017005 ACTACTGATGTTGAACATCTTGG - Intergenic
1137399416 16:48141244-48141266 ACGCGTGTTGATGGACATCGTGG - Exonic
1140503066 16:75451696-75451718 CATCCTGTTGATGGGCATCGTGG - Exonic
1140773172 16:78224564-78224586 TCCCCTGTTGTTGGACATACAGG + Intronic
1141040960 16:80671913-80671935 TCTCTTGTTGTTGGACATTTAGG - Intronic
1141395798 16:83703380-83703402 CCTCCTATTGTTGGACACTGGGG - Intronic
1142934800 17:3319768-3319790 TCTATTGTTGTTGGACATCTGGG + Intergenic
1142998901 17:3778150-3778172 TCTCCTGTTGATGGACATTTGGG - Intronic
1144395819 17:14842319-14842341 TCTTCTGTTGTTGGACACCTAGG + Intergenic
1147431462 17:40373678-40373700 TCACCTGTTGATGGACATCTGGG - Intergenic
1147645243 17:42029388-42029410 TCTCCTGTTGGTGGACATGTGGG - Intronic
1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG + Exonic
1150958668 17:69890618-69890640 ATTCCTGTTCTTGGACACAGAGG - Intergenic
1151277195 17:73044291-73044313 TCTCCTGTTGATGGACATTTGGG - Intronic
1151394305 17:73811414-73811436 TCTCCTGTTGGTAGACATCTGGG - Intergenic
1153878074 18:9394149-9394171 TCATCTGTTGTTGGACATCTAGG - Intronic
1156852203 18:41741839-41741861 TCTCCTGTTGGTGGACATTTAGG - Intergenic
1157390696 18:47300503-47300525 TCTCCTCTTGGTGGACATCTGGG + Intergenic
1157948123 18:52004018-52004040 CATTCAGTTGTTGGACATCGGGG + Intergenic
1160319343 18:77875502-77875524 TCTCCTCTTTTTGCACATCGTGG - Intergenic
1163732474 19:18957539-18957561 TCTCCTATGGTTGGACATCTAGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
927101063 2:19788216-19788238 ACTCCTGGTGCTGGGCATGGTGG + Intergenic
930260582 2:49141468-49141490 ACTCCTGTTGTTGTAAAGTGTGG - Intronic
930425706 2:51209926-51209948 TCTCCTGTTGATGGACATTTAGG - Intergenic
931379255 2:61736858-61736880 ACTATTGTTGTTGGAAATGGTGG + Intergenic
932235587 2:70118730-70118752 ATTCCTATTGTTGGACAGCCAGG - Intergenic
933986867 2:87599423-87599445 CATGCTGTTGTTGGACATCTGGG + Intergenic
935320381 2:101881978-101882000 ATTCCTGTTGTTGTACTTGGGGG + Intronic
935439863 2:103080044-103080066 TCTTCTGTTGTTGGACACCTAGG - Intergenic
936306977 2:111351385-111351407 CATGCTGTTGTTGGACATCTGGG - Intergenic
936609736 2:113990306-113990328 TCTCCTATTGTTGGACATTTAGG + Intergenic
938578471 2:132625231-132625253 ACTCCTGATGAGGGACATCCTGG + Intronic
938892298 2:135717929-135717951 TCTCCTGTTGATGGACATGTTGG - Intronic
942393469 2:175521260-175521282 TCCCCTGTTGTTGGACATTTAGG + Intergenic
944518409 2:200537155-200537177 GCTCCTGTTGTTGGACACTTGGG + Intronic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
945911619 2:215656454-215656476 TCTCCTGTTGATGGACATTCAGG + Intergenic
947099616 2:226605779-226605801 ACACCTGTTGTGGGCCATAGAGG + Intergenic
947858049 2:233337823-233337845 ATTCCTGTTATTGGACATCCTGG + Intronic
1169269965 20:4191638-4191660 TCTACTGTTGATGGACATCTGGG - Intergenic
1170641756 20:18160540-18160562 TCTCCTGTTGATGGACATTTTGG + Intronic
1170815747 20:19712744-19712766 GCTCCTGTTGATGGACATCTGGG - Intronic
1172335606 20:34112950-34112972 ACTCCTGTAGCTGGACAAAGTGG + Intergenic
1173152008 20:40575214-40575236 TCTTCTGTTGTTGGACATTTGGG - Intergenic
1173292281 20:41725454-41725476 TCACCTGTTGATGGACATTGGGG + Intergenic
1174675741 20:52352408-52352430 TCTCCTGTTGATGGACATGTGGG + Intergenic
1175045488 20:56100957-56100979 ACCCCTGATGTTGGACATTTAGG - Intergenic
1175972397 20:62693306-62693328 ACTGCTGTTGGTGGACTGCGTGG - Intergenic
1178638385 21:34325660-34325682 TCTCCTATTGTTGGACATTTAGG + Intergenic
1180575675 22:16771716-16771738 ACTATCGTTGTTGGACATCTGGG - Intergenic
1183890038 22:40919760-40919782 TCTCCTGTTGATGGACATTTTGG - Intronic
950211370 3:11126086-11126108 ACTCCTGGAGTTGGACAACAGGG - Intergenic
950294762 3:11819476-11819498 TCCCCTGTTGTTGGACATTTGGG - Intronic
953273251 3:41467560-41467582 TCTCCTGTTGATGGACACCTGGG - Intronic
953376589 3:42433524-42433546 TCTCCTGTTGATGGACATTTGGG - Intergenic
953466481 3:43125768-43125790 TCTCCTGTTGTTGGACAGTTGGG - Intergenic
954326198 3:49865535-49865557 TCACCTGTTGTTGGACATTTAGG - Intronic
954941459 3:54376797-54376819 ATTCAGGTTGTTGGACCTCGGGG + Intronic
961422332 3:126816164-126816186 ACTCCTCCTCTTGGACCTCGGGG - Intronic
961454757 3:127018395-127018417 TCTCCTGCTGCTGGTCATCGTGG + Exonic
961939913 3:130626331-130626353 ACTGCTGTTGTTGGCCAGGGAGG - Intronic
961956579 3:130810401-130810423 TCTACTGTTGTTGGACATTTAGG - Intergenic
962524404 3:136224266-136224288 ACTGCTATTGTTGGACATTGAGG + Intergenic
962698418 3:137973497-137973519 TCCCCTGTTGTTGGACATTTTGG + Intergenic
969146062 4:5125171-5125193 GCTGCTCTTGTTGGACATCTGGG - Intronic
969864080 4:10061934-10061956 TCTCCTGTTGATGGACGTCTAGG + Intergenic
976129479 4:81869778-81869800 TCTCCTGTTGATGGACACCTGGG - Intronic
980121074 4:128728553-128728575 TCTCCTGTTGATGGACATTTCGG - Intergenic
981445336 4:144830218-144830240 TCACCTGTTGATGGACATTGGGG - Intergenic
981721333 4:147804395-147804417 TCTACTGTTGGTGGACATCTAGG + Intronic
981920368 4:150079023-150079045 ACTCCTGGTGCTGGCCATCGCGG - Exonic
983143266 4:164179978-164180000 ACTTCTGATGTTGGACATTTGGG + Intronic
984383241 4:179022267-179022289 ACCCCTCTTGTTGAACATAGAGG - Intergenic
984996091 4:185431441-185431463 TCTCCTGTTGATGGACATTTGGG + Intronic
990016544 5:51069315-51069337 GCTCCTGTTGTTGGACGGCGGGG + Intergenic
990243048 5:53834786-53834808 ACTTCTGGAGTTAGACATCGTGG + Intergenic
991365524 5:65864030-65864052 TCTCCTGTTGATGGACATTTAGG + Intronic
991494764 5:67215969-67215991 CTTCCTGTTGTTGAACACCGAGG - Intergenic
992699922 5:79331663-79331685 TCACCTGTTGATGGACATCTGGG - Intergenic
993471973 5:88317323-88317345 TCACCTGTTGTTGGACACCTAGG + Intergenic
995942065 5:117598903-117598925 ACTCCTATTATTTGACATCTTGG - Intergenic
995977595 5:118059342-118059364 TTTACTGTTGATGGACATCGAGG + Intergenic
997112719 5:131092884-131092906 TCTATTGTTGTTGGACATCTGGG - Intergenic
999681750 5:154066869-154066891 ACCCCTCTTGATGGACATTGTGG + Intronic
1000332254 5:160215144-160215166 TCTCCTTTTGTTGGACAGTGAGG - Intronic
1001077367 5:168640279-168640301 TCTCCTGTTGATGGACATATGGG + Intergenic
1005792200 6:29315114-29315136 TCTCCCGTTGATGGACATCTGGG + Intergenic
1006667915 6:35710737-35710759 TCTCCTGTTGATGGACATTATGG - Intronic
1008523240 6:52382437-52382459 CCTCCTGTGGATGGACATGGAGG - Intronic
1008672472 6:53785546-53785568 TCATCTGTTGTTGGACATCTAGG - Intergenic
1009362089 6:62827081-62827103 TCTATTGTTGTTGGACATCTGGG + Intergenic
1010765055 6:79769597-79769619 ACAACTATTGTTGGACATCAAGG + Intergenic
1011305703 6:85923977-85923999 TCACCTGTTGATGGACATCAGGG + Intergenic
1013834193 6:114313433-114313455 TCACCTGTTGTTGGACATTTGGG - Intronic
1015530540 6:134217307-134217329 CCTCCTGTTGCTGGAGCTCGTGG - Intronic
1015558951 6:134494327-134494349 TCTCCTGTTAATGGACATCTGGG - Intergenic
1016261719 6:142179466-142179488 GCCCCTGTTGGTGGACATCAGGG - Intronic
1016380335 6:143471397-143471419 AATACTGCTGTTGGACATCTGGG - Exonic
1029060347 7:97791320-97791342 TCTATTGTTGTTGGACATTGGGG - Intergenic
1029950653 7:104580925-104580947 TCTCCTGTTGATGGACATTTAGG + Intronic
1030116771 7:106067768-106067790 TCTCCTGTTGATGGGCATCTGGG - Intergenic
1031647771 7:124247749-124247771 TCTACTGTTGTTGGACATTTAGG + Intergenic
1032272741 7:130425747-130425769 TCACCTGTTGAAGGACATCGGGG - Intronic
1034131409 7:148721835-148721857 TCTCCTGTTGGTGGACATGTGGG + Intronic
1037040561 8:14226624-14226646 ACTCCCGTTGTTGGCAATTGTGG + Intronic
1038342992 8:26704054-26704076 ACACCTGTTGAAGGACATCTTGG + Intergenic
1038442084 8:27577893-27577915 ACTCTTGTTGATGGACATTGGGG + Intergenic
1042630826 8:70814041-70814063 ACTATTGTTGTTGGACATTTGGG - Intergenic
1043088461 8:75867498-75867520 TCACCTGTTGATGGACATCTGGG + Intergenic
1045605866 8:103774422-103774444 TCTCCTGTTGATGGACATATGGG - Intronic
1047375987 8:124296575-124296597 ATTCCTGTTGATGGACATTTAGG + Intergenic
1051519718 9:17972556-17972578 TCTACTGTTGTTGGACATTTAGG + Intergenic
1052091362 9:24331950-24331972 TGTCCTGTTGTTGGATATCTTGG + Intergenic
1053474671 9:38373482-38373504 ACTCCTGTTGCTGGCCATTTAGG - Intergenic
1057741248 9:97713585-97713607 TCTACTGTTGATGGACATGGGGG + Intergenic
1059503008 9:114771807-114771829 ACTCTTGTTGATGGACATTTGGG + Intergenic
1059733620 9:117080356-117080378 CCTCCTATTGTTGGACATTTGGG + Intronic
1060366067 9:123015144-123015166 ACTCCTATTGTTGGACAGTTAGG + Intronic
1060447861 9:123708175-123708197 ACTCCTGTTGGTGGACCACATGG - Intronic
1060761459 9:126253880-126253902 CCTCCTATTGTTGAACATCTAGG + Intergenic
1186636096 X:11406609-11406631 TATCCTGTGGTTGGCCATCGTGG + Intronic
1187115903 X:16350265-16350287 ATTCCTGTGGTTGGGCATGGTGG - Intergenic
1187838883 X:23465017-23465039 ACCCCTGTTGTTGGAGATTTAGG - Intergenic
1191682141 X:63851977-63851999 ACTCCTGTTATTGGTCACTGAGG + Intergenic
1192308918 X:69992544-69992566 TCTCCTGTTGGTGGACAATGAGG + Intronic
1193358170 X:80547723-80547745 CCTACTGTTGATGGACATCTAGG - Intergenic
1193570417 X:83134713-83134735 TCTCCTGTTGATGGGCATCTAGG - Intergenic
1193663348 X:84284152-84284174 CATGCTGTTGTTGGACATCTAGG + Intergenic
1194519783 X:94904061-94904083 TCTCCTGTTGTTGGATAAAGTGG + Intergenic
1195082112 X:101381201-101381223 TCTCCTGTTGATGGACATTTAGG + Intronic
1196078307 X:111602029-111602051 TCACCTGTTGATGGACATCTGGG + Intergenic
1196521188 X:116674205-116674227 TCTCCTGTTGATGGACATTTAGG + Intergenic
1197258390 X:124288926-124288948 TCATCTGTTGTTGGACATCTAGG + Intronic
1198488215 X:137109814-137109836 TCTCCTGTTGATGAACATTGGGG + Intergenic
1200307312 X:155040579-155040601 ACATCTGTTGGTGGACATCTGGG + Intronic
1202074639 Y:21025943-21025965 ACTCCTGTTGTTGGACCATCTGG + Intergenic