ID: 1093439222

View in Genome Browser
Species Human (GRCh38)
Location 12:19173658-19173680
Sequence TCCCTTTGGCTCCAGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093439216_1093439222 29 Left 1093439216 12:19173606-19173628 CCTCAAAGATTCTCAAATCACTC 0: 1
1: 0
2: 3
3: 22
4: 266
Right 1093439222 12:19173658-19173680 TCCCTTTGGCTCCAGGGAACAGG 0: 1
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093439222 Original CRISPR TCCCTTTGGCTCCAGGGAAC AGG Intronic
900143336 1:1147432-1147454 CCCCTTGGGCTCCAGGCACCGGG - Intergenic
900971825 1:5996120-5996142 TCCCTTTGCCTCCTCGGGACTGG - Intronic
901129831 1:6955315-6955337 TGCCTCTGGCGCCAGGGAAGAGG - Intronic
901479211 1:9512863-9512885 TCTTTATGGCACCAGGGAACAGG + Intergenic
902845085 1:19104051-19104073 TGCCTTAGGCTCCAGGCCACTGG + Intronic
904001885 1:27343364-27343386 GCCCTGTGGCTCCAGGCAACAGG + Intronic
904078612 1:27858142-27858164 TCCAATTCCCTCCAGGGAACAGG - Intergenic
904471094 1:30736831-30736853 TCCCTGTGGCTTCAGGCCACAGG + Intronic
904651366 1:32008379-32008401 GCCTTTTGTCTCCTGGGAACTGG + Intergenic
905261933 1:36725697-36725719 TGACTTTGTCACCAGGGAACAGG + Intergenic
908253840 1:62286386-62286408 TCCTTTTTGCTCCCGGGAATAGG + Intronic
908351131 1:63286892-63286914 TCCCCATGGACCCAGGGAACAGG + Intergenic
910226776 1:84943956-84943978 TCCCCTTGGATCCATGGAATGGG + Intronic
912964328 1:114224343-114224365 TCCCTTTGACCCCAGGCCACTGG - Intergenic
913237360 1:116796501-116796523 TCCCTGTGTCTCCAGGGACAAGG + Intergenic
915143216 1:153779459-153779481 TTCCTCAGGCTCCAGGTAACCGG + Exonic
915599305 1:156912648-156912670 ACCCATTGTCCCCAGGGAACTGG + Intronic
918106517 1:181419972-181419994 TCCCTTTGGCTCTAGGACAGGGG + Intronic
920008519 1:202851015-202851037 TTGCTTTGGCTTCAGGAAACTGG - Intergenic
922141820 1:222894739-222894761 TCCCGCTGGCTCCCTGGAACAGG + Intronic
922782273 1:228262753-228262775 TGCCTTTGGGTCCAGGTATCTGG - Intronic
923162041 1:231323139-231323161 TGCAGTTGGCCCCAGGGAACAGG + Intergenic
923927342 1:238647555-238647577 TCCCTTTGGCTTTAGGGAGATGG - Intergenic
1067733489 10:48830893-48830915 TCCACTCGGCTCCAGGGAATGGG + Intronic
1070829469 10:79409719-79409741 TCCCTGATGGTCCAGGGAACGGG + Intronic
1073011460 10:100363075-100363097 TCACCCTGACTCCAGGGAACAGG - Exonic
1073133565 10:101206529-101206551 TGCCTCAGCCTCCAGGGAACTGG - Intergenic
1074008288 10:109450865-109450887 TGCCTTAGCCCCCAGGGAACTGG + Intergenic
1074497424 10:113992294-113992316 CCCCTTTTGTTCCTGGGAACGGG - Intergenic
1075258757 10:120945277-120945299 TCCTGTTGGCTGCAGGGGACAGG - Intergenic
1075588213 10:123672471-123672493 TCCCTGGGCCTCCAGGGACCTGG - Intronic
1076014384 10:127015797-127015819 ACCCTGTGGCTACAGGGAATGGG - Intronic
1077110998 11:862237-862259 TCCCTTTGGCTCCAGGCCAGGGG + Intronic
1077708896 11:4515810-4515832 CCCCTTTGGCTCCATGTACCTGG - Intergenic
1077711846 11:4545283-4545305 CCCCTTTGGCTCCATGTACCTGG + Exonic
1078565880 11:12413694-12413716 CCCCGTAGGCTCCAGGGAGCTGG + Intronic
1081825975 11:46052093-46052115 TCCTTTTGTGGCCAGGGAACTGG - Intronic
1081936437 11:46907218-46907240 TCCCTTAGCCTCCAGGGGCCTGG + Intronic
1082263684 11:50097255-50097277 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1083310126 11:61779720-61779742 TCCCTTTGCCCCCGGGGAAATGG + Intronic
1084692359 11:70734689-70734711 CCCCTTGGCCTCCAGGGCACAGG - Intronic
1085312273 11:75523904-75523926 TCCCCTTGACTCCAGGGAGTTGG + Intronic
1086137571 11:83457285-83457307 TCTCTATGGCTCCAATGAACTGG - Intronic
1088455106 11:110025193-110025215 TTCTTTTGTCTCCAGGGATCTGG - Intergenic
1090988508 11:131795021-131795043 CCCCTTTGGCTACAGGGTCCAGG - Intronic
1091903537 12:4164775-4164797 TCCCCCAGGCTCCAGGGAAGGGG - Intergenic
1093439222 12:19173658-19173680 TCCCTTTGGCTCCAGGGAACAGG + Intronic
1095599558 12:44000145-44000167 CCCCTTTGGCTCCTGGGAGGTGG + Intronic
1096402575 12:51319348-51319370 TTACTTTGGCTCCAGAGTACTGG - Intronic
1098152180 12:67558031-67558053 TCCCTTTGGTTCAAGGAGACTGG + Intergenic
1098483785 12:70997196-70997218 TCCCTTAGGCTCAAGGCAAGGGG - Intergenic
1100636260 12:96437598-96437620 AACCTTTGCCTCCAGGGTACAGG + Intergenic
1102014815 12:109641078-109641100 GGCCTTTAGGTCCAGGGAACTGG + Intergenic
1104793424 12:131498852-131498874 TGCTTTGGGCTCCAGGGAATGGG - Intergenic
1105672974 13:22641453-22641475 TCTCTTTGGTTCCAGTGATCTGG + Intergenic
1107665344 13:42683107-42683129 TCATTTTAGCTCCAGGGGACAGG + Intergenic
1108364967 13:49701525-49701547 AGCCTGTGGCACCAGGGAACAGG + Exonic
1109124405 13:58502212-58502234 TCCCGTTAACCCCAGGGAACTGG - Intergenic
1110645508 13:77879037-77879059 TCCCTTAGGATTCAGGGATCTGG + Intergenic
1111536886 13:89612970-89612992 TCCCTTAGCCTCCAAGGACCTGG - Intergenic
1112259589 13:97866239-97866261 TCACTTTGGGTCCAGGGCTCAGG + Intergenic
1112278761 13:98044604-98044626 TCCCCTTGGCCCCAGGGAGCGGG - Intergenic
1113927719 13:113950792-113950814 TCCCTCCCGCTCCAGGGCACGGG + Intergenic
1118817888 14:69325559-69325581 CTCCTTTGACACCAGGGAACAGG - Intronic
1121245390 14:92458181-92458203 TCCCTTTGCTTCCTGGGAGCTGG + Intronic
1121277700 14:92679027-92679049 TCCCCTAGGCTTCTGGGAACAGG - Intronic
1121326785 14:93024820-93024842 TCCCTGTGGCTCCGGGACACAGG + Intronic
1121502429 14:94448740-94448762 TGGCTTTGGCTACTGGGAACAGG - Exonic
1121879750 14:97489354-97489376 TCCATTTGACCCCAGGAAACAGG - Intergenic
1122245429 14:100399832-100399854 TCCCTGTGGCTCCAGAAGACTGG + Intronic
1123866672 15:24526272-24526294 TCTTTATGGCACCAGGGAACAGG + Intergenic
1124658129 15:31524890-31524912 TCCCTCGGGCCCCAGGGAGCAGG + Intronic
1124937015 15:34183078-34183100 TTCTTTTGTCTCCAGGAAACTGG + Intronic
1126134691 15:45378607-45378629 CCCCATTGGCTGCCGGGAACAGG + Exonic
1127050361 15:55076783-55076805 TTCCTTTGGCTACAGAGAGCAGG - Intergenic
1127523129 15:59762888-59762910 TCCCTTTGGCACCAGGTATCAGG - Intergenic
1129390636 15:75218953-75218975 ACCCCTGGGCTACAGGGAACAGG - Intergenic
1129779449 15:78260476-78260498 TCCCTTTAGCAGCAGGGAAAGGG - Intergenic
1132636867 16:954091-954113 TCCCTCTGGCTCCAGTAAGCTGG + Intronic
1132877329 16:2145913-2145935 TCCCGTTTCCTCCAAGGAACTGG + Intronic
1133283589 16:4680523-4680545 TCCCTTGTGCCCCAGGGAGCAGG + Intronic
1133971105 16:10568729-10568751 TCCCTTTGCTTCTAGGTAACTGG - Intronic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136990328 16:35147903-35147925 TCCGTCTGGCTCCAGGCCACGGG + Intergenic
1137235798 16:46616542-46616564 TCCCTTTGGCTCCAGCAAGAAGG - Intronic
1138336321 16:56256254-56256276 CCCCTTTGGCTACAGGGCAGGGG + Intronic
1141819165 16:86433104-86433126 ACCCCTTGGCTCCAGGGCACTGG - Intergenic
1142243726 16:88958901-88958923 TCCCTTTGCCTCCATGGAGCGGG + Intronic
1144810474 17:17995603-17995625 TCCTCTGGGCTCCAGGCAACTGG - Intronic
1145185201 17:20787867-20787889 TCACCCTGACTCCAGGGAACAGG - Intergenic
1146306483 17:31733498-31733520 GCACAGTGGCTCCAGGGAACGGG + Intergenic
1148438925 17:47701836-47701858 GCCCTTTGGCTGGAGGGAGCTGG + Intronic
1150161093 17:62898756-62898778 TACCAGTGACTCCAGGGAACTGG - Intergenic
1150843618 17:68633000-68633022 AACAGTTGGCTCCAGGGAACAGG - Intergenic
1151194731 17:72423501-72423523 AAACTTTGGCTCCAGGGACCTGG + Intergenic
1152944660 17:83192351-83192373 TCACTGTGGCTCCGTGGAACTGG - Intergenic
1154217779 18:12428200-12428222 TCCCTTTGTGTCCAGGGCACTGG + Intronic
1157729618 18:49992198-49992220 TCTCTTTGGGTCCAGGGAGTGGG + Intronic
1165290740 19:34883212-34883234 TCCCTCTGGAACCAGGGAACAGG - Intergenic
1168441815 19:56374710-56374732 TGCCTTTGGCTCCTGGGAGATGG - Intergenic
925048927 2:796227-796249 TCCCTCAGGCCCCTGGGAACAGG + Intergenic
925574860 2:5349900-5349922 TCCCTATGGCACCTCGGAACTGG + Intergenic
925906722 2:8544231-8544253 TCATTTTGGCTTCAGGGAGCCGG - Intergenic
927848088 2:26481762-26481784 TCCCTTTAGCACCTGGAAACCGG + Intronic
928197254 2:29224824-29224846 TCCCTTTGCCTGCAGGGGCCTGG + Intronic
928755193 2:34516299-34516321 TTTATTTGGCTCCAGGGAAATGG - Intergenic
929788565 2:45008501-45008523 TCCCTTGGGCCCCGGGGAGCTGG + Intronic
930205680 2:48584817-48584839 TCCCATGGCCTCCAGGGTACGGG - Intronic
930911879 2:56638704-56638726 AACCTTCAGCTCCAGGGAACAGG - Intergenic
932598869 2:73110969-73110991 CCCCTTGGGCTCCAGGAACCAGG + Intronic
936489114 2:112955421-112955443 TCTCCTTGGCTGCAGGGAACAGG - Intergenic
936818014 2:116484378-116484400 TCACTGTGGCTCCAGGGATGTGG - Intergenic
937842299 2:126535861-126535883 TCCATGTGGCTCCAGGGAATTGG - Intergenic
938195006 2:129319288-129319310 TGCCTCTGGCTCCAGGAAGCAGG - Intergenic
939175815 2:138746352-138746374 TCACTTTGCCTCCAGGCACCTGG + Intronic
939456623 2:142445682-142445704 ACCCTGTGGCTCAAGGGAGCAGG - Intergenic
940983180 2:160025066-160025088 GAGGTTTGGCTCCAGGGAACAGG - Intronic
941670677 2:168289103-168289125 TCCCTTTGGGCACAGGTAACTGG + Intergenic
944415878 2:199479202-199479224 TACCTTTTTCTCCATGGAACAGG - Intergenic
945412272 2:209524927-209524949 TCCCTTGGGATCCAGAGACCTGG + Intronic
946822952 2:223648886-223648908 TCCATTTTGCCCCAGGGAACAGG + Intergenic
946963829 2:225015054-225015076 TTCTTTTCGCTCCTGGGAACAGG + Intronic
1170777511 20:19390641-19390663 TCCCTGTGACTCCAAGCAACAGG - Intronic
1170777534 20:19390782-19390804 TCCCTTTGGCCTCAGGCACCAGG - Intronic
1171943137 20:31350229-31350251 TCCCATTGCCTTCAGGGAAAGGG - Intergenic
1173343490 20:42176448-42176470 TCACTGTGGCTCCAGGGGACTGG + Intronic
1175895801 20:62335119-62335141 TCCCTTGGCCCCCAGGGCACCGG - Exonic
1176412672 21:6457466-6457488 TCCCTTAGGGCCCAGGGAAGAGG + Intergenic
1176594853 21:8683487-8683509 TCCCTTTGCCCCCAGGGCCCAGG - Intergenic
1177043982 21:16146550-16146572 TCACAATGGCTCCAGGGAAATGG - Intergenic
1179139491 21:38712180-38712202 TGCCTCTGGCTGCAAGGAACAGG + Intergenic
1179688166 21:43065788-43065810 TCCCTTAGGGCCCAGGGAAGAGG + Intronic
1182567726 22:31212470-31212492 TCCCTCAGGCGCCATGGAACCGG - Intronic
1183163717 22:36132077-36132099 ATCCTGTGGCTCCAGGGAGCCGG - Intergenic
1183193350 22:36336026-36336048 TCCCTTGGGAACCAGGGATCGGG + Intronic
1184486577 22:44783445-44783467 TCCCTCTGGCTGCAGAGAAGGGG - Intronic
950902906 3:16513365-16513387 TCCGTTTGGCCCCATGGACCGGG - Intronic
955218684 3:57006165-57006187 TTTATGTGGCTCCAGGGAACAGG - Intronic
955712401 3:61793784-61793806 TCCTTTTAGCTCAAGGAAACTGG - Intronic
958535481 3:95398070-95398092 TCCATTTTGCCCCATGGAACAGG + Intergenic
959344564 3:105177181-105177203 TCCCTGTGTCTTCAGGGAACAGG + Intergenic
960087838 3:113609468-113609490 CACCTTTGGCTCCAGGGACAGGG - Intronic
966668364 3:182498393-182498415 TCTCTTTGGCTCCTTGGCACTGG + Intergenic
969485713 4:7471505-7471527 TCCCCTTCGTTCCAGGGAAGAGG + Intronic
974328137 4:60443271-60443293 TCCCATTGGCTCCAGGACTCAGG - Intergenic
977899634 4:102404707-102404729 TCCCTGGGTCTCCAGGGAATTGG - Intronic
986022769 5:3820453-3820475 TCCCTTCCCCTCCAGGCAACAGG - Intergenic
987739111 5:21882745-21882767 TCCCTTTGGCTCCATTGTAACGG - Intronic
991166879 5:63573630-63573652 CCCCTTTGTCTCCAGCAAACAGG + Intergenic
991507919 5:67343877-67343899 TGGCTTGGGCTCCAGGGAAGAGG - Intergenic
992588694 5:78270673-78270695 TCCCTTTGGCTACATAGCACTGG - Intronic
995104670 5:108361865-108361887 TCCCTCTGGAACCAGGGATCTGG + Intronic
995217730 5:109614407-109614429 TCAGTCTGGCTCCATGGAACTGG + Intergenic
996024374 5:118628834-118628856 CCCCCTTTGCTCCAGGGAAAGGG + Intergenic
1001695739 5:173668328-173668350 TCACCTTGGCTTCTGGGAACAGG + Intergenic
1004362568 6:14984291-14984313 TCACTTTGGCTTCAGGGAGAAGG + Intergenic
1007972781 6:46069245-46069267 TCCCTATTGCTCCAGGAAAAAGG - Intronic
1008122324 6:47632753-47632775 TCCCTCTCTCTCCATGGAACTGG - Intergenic
1008148960 6:47927028-47927050 GCCCTTTGCCTCCAGGGAAGAGG + Intronic
1014263759 6:119250955-119250977 TCCCTTGGACTCAAGTGAACAGG + Intronic
1014975018 6:127869758-127869780 GCCCTTTGGCTAAAGAGAACAGG - Intronic
1015705182 6:136080152-136080174 TCCCTGTGTCTCTAGAGAACAGG + Intronic
1015832792 6:137388007-137388029 TACTTTTGGCACCAGGGATCAGG - Intergenic
1017821298 6:158050759-158050781 TGCCCTTGAGTCCAGGGAACAGG - Intronic
1018381907 6:163265379-163265401 TCCCTTCTTCTCCAGGGAAGGGG + Intronic
1018428365 6:163703321-163703343 TCTGTGTGGCTCCAGGGAATTGG - Intergenic
1019773582 7:2898875-2898897 TCCCTGTGGTTCCAGGGACATGG + Intergenic
1019906873 7:4071524-4071546 TTCCTTCGACTCCAGGCAACAGG - Intronic
1023377005 7:39566448-39566470 CCCCTTTGTCTCCAGGGCCCTGG - Exonic
1025980341 7:66400076-66400098 TTCCTCTGGCTTCAGTGAACAGG + Intronic
1026776274 7:73232991-73233013 GCCCCATGGCTCCAGGGAAATGG - Intergenic
1027017128 7:74786360-74786382 GCCCCATGGCTCCAGGGAAATGG - Intronic
1027070897 7:75159572-75159594 GCCCCATGGCTCCAGGGAAATGG + Intergenic
1027205225 7:76092448-76092470 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1027724012 7:81780326-81780348 TGCCTTTGCCTCCAGAGAGCTGG + Intergenic
1030071102 7:105698200-105698222 TCCCTGTGAATCCAGGTAACAGG - Intronic
1030304223 7:108002887-108002909 TCCCCGTGGCTGCAGGGAGCCGG - Exonic
1030814307 7:114016211-114016233 TCTCTTAGTCTCCAGGGCACAGG + Intronic
1033429343 7:141274770-141274792 TCCCTTTGGCCCCTGGGCAAAGG + Intronic
1033567448 7:142593032-142593054 GCCCTTTGTCTCCTTGGAACAGG + Intergenic
1035710071 8:1706354-1706376 TCCTTTGAGCTCCTGGGAACAGG + Exonic
1036727175 8:11230559-11230581 TCGCCTGGGTTCCAGGGAACAGG + Intergenic
1036748470 8:11427492-11427514 TCAGTTTGGCTCCAGGCACCAGG - Intronic
1037098420 8:15014263-15014285 TCCCTTGGCCTCCATGGAACTGG - Intronic
1037924743 8:22835399-22835421 TCTCTCTGGCTCCAGGCAGCTGG - Intronic
1038165705 8:25083314-25083336 TCCCTATGGCTCAAGGCAGCTGG - Intergenic
1041077488 8:54182328-54182350 TCCCTTTGACTGCCTGGAACAGG - Intergenic
1045511146 8:102812984-102813006 CCCCTTTGGCTCCCGGGAACTGG - Intergenic
1046217342 8:111165293-111165315 TCCCTCTGGAGCCAGGGACCAGG + Intergenic
1046991786 8:120466091-120466113 TCCCTTTTGCTGCATTGAACTGG - Intronic
1047843999 8:128786261-128786283 TCCCTTTGGCCCAAGTGAAAGGG - Intergenic
1049176735 8:141197403-141197425 TCCCTGTGGCTCCAGGATCCTGG - Intergenic
1049426111 8:142538602-142538624 GCCCTGGGGCTCCAGGGGACAGG - Intronic
1049600207 8:143504073-143504095 TCCCTCGGGCTGCAGGGAAGGGG + Intronic
1051017430 9:12495951-12495973 TCCCTTTGGTTCATGGGAAAAGG - Intergenic
1052886055 9:33649158-33649180 GCCTTTTGTCTCCTGGGAACAGG + Intergenic
1055057864 9:72040073-72040095 TCTTTTTGGCACCAGGGACCGGG + Intergenic
1060204436 9:121674297-121674319 TGCCTTCTGCTCCAGGGCACTGG - Intronic
1060774879 9:126365727-126365749 TCCCTTTGGACCCAGGAAAGTGG - Intronic
1060993149 9:127860447-127860469 TCCCCCTGGCTCCAGGGCCCTGG + Intergenic
1062433934 9:136538175-136538197 TCCCTTTGCTCCCAGGGAGCAGG + Intronic
1186297306 X:8164218-8164240 GCTCTGTGGCTCCGGGGAACTGG - Intergenic
1186655208 X:11604924-11604946 TATCCTTGGCCCCAGGGAACTGG - Intronic
1188554971 X:31400905-31400927 TCTCTTTGGCTCCAGTGGGCAGG + Intronic
1190457944 X:50643651-50643673 TCCCTTTGCCACCAGGGTGCTGG - Intronic
1191597233 X:62959281-62959303 TCCCAATGACTCCAGGGAATGGG + Intergenic
1192188700 X:68977339-68977361 GTCCTTTGGCTACAGAGAACAGG + Intergenic
1194474761 X:94345316-94345338 ACCCTTTGACTCCAGGATACGGG - Intergenic
1198728601 X:139703024-139703046 CCCATTTGGGACCAGGGAACTGG - Intronic
1198940687 X:141952505-141952527 ACCCTGTGGCTCCAGGCATCAGG - Intergenic
1199196797 X:145041581-145041603 TCCCGGTGGCTCCTGGGAAGGGG + Intergenic