ID: 1093442816

View in Genome Browser
Species Human (GRCh38)
Location 12:19219166-19219188
Sequence TCACATACATGGGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 2, 2: 4, 3: 41, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093442816 Original CRISPR TCACATACATGGGCTCTGCA AGG Intronic
900743715 1:4345911-4345933 TCACATTCATGGGCTCTAGATGG + Intergenic
901701281 1:11045898-11045920 TCACACAGTTGGTCTCTGCAGGG + Intronic
901984900 1:13067418-13067440 TCATCTAAATGGGCCCTGCAAGG - Intronic
901996909 1:13159352-13159374 TCATCTAAATGGGCCCTGCAAGG + Intergenic
902597649 1:17520288-17520310 TCACACACCTGGGCTCTGTGTGG + Intergenic
902642641 1:17776532-17776554 TCACAGAGAGGGGGTCTGCAAGG - Intronic
906525904 1:46493135-46493157 TCATTTACATGGGCACTGCGGGG - Intergenic
907536384 1:55163841-55163863 TCATATACGTGAGCTCTGCAGGG + Intronic
918276709 1:182959805-182959827 TGACATCCAGGGGCTCCGCAAGG - Intergenic
918870224 1:189962589-189962611 TCTAATTCATGGGATCTGCAAGG + Intergenic
921497545 1:215859589-215859611 TCATATACATGGATTCTGCACGG + Intronic
922160363 1:223075028-223075050 GCACAGTCATGGGCTGTGCAGGG + Intergenic
922466992 1:225851181-225851203 TGACATACAGGGGCTCAGCATGG - Intronic
922534518 1:226370043-226370065 TCTCCTCCATGGGTTCTGCAGGG + Intronic
922560921 1:226568991-226569013 GCACATGCATGGGCACAGCAAGG - Intronic
922793297 1:228322601-228322623 TCATATATATAGGTTCTGCAGGG - Intronic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
1062811651 10:470925-470947 TCACAGACAGGGTGTCTGCATGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063912527 10:10846478-10846500 TCACATACATAGACTCTTCTGGG - Intergenic
1067780674 10:49203801-49203823 TCACTTACATGGGATCTTCTTGG - Intergenic
1069346059 10:67471192-67471214 TCACATCCCTGGCCTCTACATGG + Intronic
1071250441 10:83813331-83813353 TCTTATAGGTGGGCTCTGCAAGG + Intergenic
1071466364 10:85943614-85943636 TCATAGAGGTGGGCTCTGCAGGG - Intronic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1072922920 10:99591809-99591831 TGACATTTATTGGCTCTGCATGG + Intergenic
1073779691 10:106824011-106824033 TCACATACATGGGCCTGGCGTGG + Intronic
1074790343 10:116880296-116880318 TAACTTTCATGGGCTGTGCAGGG - Intronic
1075289923 10:121220231-121220253 TCATATACCTTGGTTCTGCAGGG - Intergenic
1075674323 10:124285706-124285728 TCACATATATGAGCTCTCTAGGG + Intergenic
1076206308 10:128607137-128607159 TGACAGACCTGGGCTCTGCTGGG - Intergenic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1083196821 11:61093205-61093227 TCACATCCCTGGGCTTAGCATGG + Intergenic
1083281146 11:61628060-61628082 TCTGATACATGGGCTCCCCAGGG + Intergenic
1084724789 11:70934435-70934457 TCAAACACAGGGGCTCTGCCTGG + Intronic
1085779828 11:79397923-79397945 TCATATAAATGGGCCTTGCATGG - Intronic
1086346520 11:85902804-85902826 GTATAAACATGGGCTCTGCAGGG - Intronic
1088295027 11:108283737-108283759 TCATATACGTGGGTTCTGCAGGG - Intronic
1088719903 11:112583121-112583143 TCACATATCTGGGCTCAGCTGGG - Intergenic
1088870014 11:113882779-113882801 TCCTATACGTGGGTTCTGCAGGG - Intergenic
1089610228 11:119664720-119664742 TCACAGACAGAGGCTCTGGAAGG + Exonic
1089645457 11:119875930-119875952 TCACACACCTGGGCTGAGCAGGG + Intergenic
1090829513 11:130411227-130411249 CCACCTAAATGGGCTCTGCAAGG - Intronic
1092280053 12:7091807-7091829 TCACAGACATGTTCTCAGCAGGG + Intronic
1092295765 12:7199003-7199025 ACACAGACAAGGGGTCTGCAAGG - Exonic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1093751023 12:22800258-22800280 TTCCATACATGGGCTGTGCAAGG - Intergenic
1094282538 12:28755505-28755527 TCACATTCCTGGGCTCTCTAGGG + Intergenic
1096634710 12:52950789-52950811 CGACATCCATGGGCTCCGCAAGG + Exonic
1097950237 12:65419459-65419481 CGACATCTATGGGCTCTGCAAGG - Intronic
1098958936 12:76718212-76718234 TCAGAAAGCTGGGCTCTGCAGGG - Intergenic
1099509870 12:83521094-83521116 TCAAACACAAGGGTTCTGCAAGG - Intergenic
1101468988 12:104977479-104977501 TGACATCCATGGGCTCCGCAAGG - Intergenic
1104180510 12:126375704-126375726 TCACAGACATGGTCTCTTAATGG + Intergenic
1104439012 12:128780148-128780170 TCACCTACCTGGGCTGGGCAGGG - Intergenic
1104634179 12:130427405-130427427 CCGCATTCATGTGCTCTGCAGGG - Intronic
1105286955 13:19012311-19012333 TCACATGAATGCCCTCTGCAAGG + Intergenic
1106698970 13:32208718-32208740 TCACATACAGGAGCTCCCCAAGG - Intronic
1108722795 13:53149056-53149078 TCACAAACATGGGCCTTGGATGG - Intergenic
1111377828 13:87403627-87403649 GCAAATACATGGTCACTGCAAGG - Intergenic
1111581683 13:90230930-90230952 TGACATCCATGGGCTCTGCAAGG + Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1113346522 13:109483239-109483261 TCACAGCCATGCGTTCTGCAGGG + Intergenic
1113798257 13:113072198-113072220 TCAAATACGTGTGCTCAGCAAGG - Intronic
1113999590 14:16401149-16401171 TCTCTTCCAGGGGCTCTGCAAGG - Intergenic
1116993947 14:51303264-51303286 GCAGACACATGGGCTCTGCCAGG - Intergenic
1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG + Intergenic
1118616644 14:67578617-67578639 TCACTCACCTGGGATCTGCATGG - Exonic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1119054816 14:71408589-71408611 GCACAAACCTGGGCTCTGCTTGG - Intronic
1120218725 14:81708435-81708457 TCAGATACATGGGCTAAGTAAGG + Intergenic
1120482513 14:85069668-85069690 ACAAATACATGAGCTCAGCAAGG - Intergenic
1121974545 14:98390843-98390865 TCACAGACATGACCTCTGCAAGG + Intergenic
1123774595 15:23566091-23566113 TTATATACATGGGCAGTGCAAGG + Exonic
1124115621 15:26840814-26840836 TGAAATACATGCTCTCTGCAAGG + Intronic
1124366654 15:29076622-29076644 TCTCCTACAGGGGCCCTGCAAGG - Intronic
1126431998 15:48596199-48596221 GCACAGACATTGGGTCTGCATGG - Intronic
1127366858 15:58299413-58299435 TCACAGCCATGGGCTCTGAAGGG + Intronic
1129577797 15:76770184-76770206 TCACATACCTGGGCTGGTCAGGG + Intronic
1132017695 15:98333326-98333348 TCAGAGGCATGGGGTCTGCAAGG + Intergenic
1135302134 16:21339801-21339823 TCAGATACATAGGCTGGGCACGG - Intergenic
1135995211 16:27242864-27242886 GCTGATACAGGGGCTCTGCAGGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1139087349 16:63603121-63603143 TCACCTATATGGGCCATGCATGG + Intergenic
1140181962 16:72729154-72729176 TGACATCCATGGGCTCTGCAAGG + Intergenic
1140728397 16:77834405-77834427 TCAGATGCATGGGCCCTGCTAGG - Intronic
1140862597 16:79031242-79031264 CCCCACACGTGGGCTCTGCAGGG - Intronic
1143567649 17:7734223-7734245 TCATGTTCATGGCCTCTGCAGGG - Exonic
1144220937 17:13099299-13099321 TCACACACCAGGGCTCTGGAGGG + Intergenic
1144792295 17:17867202-17867224 TCACACACCTGGGCCCTGGAGGG + Intronic
1145871427 17:28276782-28276804 TGACATCCATGGGCTCCACAAGG - Intergenic
1149324590 17:55516997-55517019 TCACCTAGATGGGCACTCCAAGG + Intergenic
1149936340 17:60810705-60810727 GGACATCCATGGGCTCTGCAAGG + Intronic
1150877632 17:68987112-68987134 ACACATACAGGGGTTCTGTAAGG - Intronic
1151215285 17:72572884-72572906 GCAGATTCATGAGCTCTGCAAGG - Intergenic
1152285895 17:79413222-79413244 GCACAGAAATGGGCACTGCAGGG - Intronic
1152830227 17:82492703-82492725 TGACAGACATGGCATCTGCATGG + Intergenic
1153206863 18:2712544-2712566 TCATATACACAGGTTCTGCAGGG + Intronic
1153907865 18:9678975-9678997 TGACATCCATGGGCTCCGCAAGG - Intergenic
1157352999 18:46907770-46907792 TCCTATACATGGGTTCTGCAGGG + Intronic
1157672659 18:49543336-49543358 TCATATTTATGGGTTCTGCAGGG + Intergenic
1160287134 18:77554182-77554204 TTAAATACTTGTGCTCTGCAAGG + Intergenic
1167774157 19:51543838-51543860 TCACCTTCATGGGTTCTCCATGG + Intergenic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
926226440 2:10970485-10970507 TCGGATCCTTGGGCTCTGCAGGG - Intergenic
928495097 2:31823334-31823356 CGACATCCATGGGCTCTGCGAGG - Intergenic
928741108 2:34353430-34353452 TAAAAAACATGGGCTCTGGAGGG - Intergenic
929214240 2:39393796-39393818 TCATATACACAGGTTCTGCAGGG - Intronic
929849002 2:45564834-45564856 TCATATACATGGGTTCTGCAGGG + Intronic
930063494 2:47310250-47310272 CCACAGACTTGGGCTCTGAAAGG + Intergenic
930234618 2:48876820-48876842 TCACCAACATAGGCTCAGCATGG - Intergenic
931791394 2:65667004-65667026 CGACATCCATGGGCTCCGCAAGG + Intergenic
935168486 2:100590732-100590754 GCACACACATGGGCTGGGCACGG + Intergenic
937288828 2:120769611-120769633 GCACATGCATGAGCACTGCAGGG - Intronic
941417310 2:165237251-165237273 TCTCTTACATGGGCTCCGTATGG - Intergenic
941491722 2:166150852-166150874 TCACATACATTAGCTCTCCAAGG - Intergenic
942971373 2:181961917-181961939 TGACATCCATGGGCTCCACAAGG - Intronic
943548666 2:189311977-189311999 TGACATCCATGGGCTCCACAAGG - Intergenic
943715380 2:191146125-191146147 ACACAGAGATGGGCTCTGCCTGG + Intronic
948087811 2:235265970-235265992 TCACCCTCCTGGGCTCTGCACGG - Intergenic
948607624 2:239146318-239146340 AAACCCACATGGGCTCTGCAGGG + Intronic
948824967 2:240569593-240569615 AGACACACATAGGCTCTGCAGGG + Intronic
1168957327 20:1843421-1843443 TCACATACCTATGATCTGCATGG - Intergenic
1170873393 20:20229127-20229149 TCAGAAAAATGGGCTCTGAAAGG - Intronic
1171140087 20:22733528-22733550 CTACCTCCATGGGCTCTGCAAGG - Intergenic
1171727010 20:28633299-28633321 TCTCTTCCAGGGGCTCTGCAAGG - Intergenic
1171751250 20:29051319-29051341 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1171856619 20:30350270-30350292 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1173448416 20:43140765-43140787 TCACACACAGTGGCTCTGTAAGG - Intronic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1174454887 20:50641958-50641980 ACACATCCAAGGGCTCTGCAGGG - Intronic
1174471915 20:50767772-50767794 ACACATCCAAGGGCTCTGCAGGG + Intergenic
1174668624 20:52284550-52284572 TCCCATAGATGTGCTCTCCAGGG + Intergenic
1175844035 20:62049299-62049321 TCCCAAACATGTGCCCTGCAGGG + Intronic
1177917900 21:27113791-27113813 TCACATAGATGCACTCGGCAGGG + Intergenic
1179004528 21:37499972-37499994 TCACATATGTGGGTTCCGCATGG + Intronic
1180391350 22:12285717-12285739 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1180408392 22:12579037-12579059 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181133493 22:20748499-20748521 TCACACCCCTGGGCTCTGCCAGG - Intronic
1182966255 22:34524066-34524088 TCACATGCATAGGGACTGCATGG - Intergenic
1183617311 22:38953650-38953672 TCACATGCATGGACTGTCCAGGG + Intronic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
949615848 3:5752989-5753011 TCAAATACATGGTCTCTTCTGGG + Intergenic
949966974 3:9364937-9364959 TTAAAAACATGGGCTCTGGAGGG - Intronic
950277128 3:11671518-11671540 TCATACAGGTGGGCTCTGCAGGG - Intronic
951725263 3:25750890-25750912 TTATATACATGGGTTCTGCAGGG - Intronic
951769120 3:26235357-26235379 TCTCATTCATTGTCTCTGCAGGG - Intergenic
952319138 3:32259477-32259499 TGACATTCATGGGCTCTTCAAGG + Intronic
953405427 3:42657446-42657468 TCTCACTCAGGGGCTCTGCAGGG - Intronic
955059502 3:55483409-55483431 ACACATACATCGGCTCTGTAGGG + Intronic
955081935 3:55665833-55665855 TTCCATACATGGACTCTGCTAGG + Intronic
955425851 3:58788912-58788934 TCATATATGTGGGTTCTGCATGG - Intronic
955631593 3:60981076-60981098 TCATAGCCAAGGGCTCTGCAAGG + Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
956677318 3:71748287-71748309 TCATATATATGGGTTCTGCAGGG + Intronic
957468776 3:80631099-80631121 TTACTTACATTGGATCTGCAAGG - Intergenic
959333782 3:105039209-105039231 TCAGAAGAATGGGCTCTGCAAGG + Intergenic
961141176 3:124557807-124557829 TCAGATCCAAGTGCTCTGCAAGG + Intronic
965544711 3:169903696-169903718 CAACATCCGTGGGCTCTGCAAGG - Intergenic
967594881 3:191317089-191317111 CCACCCCCATGGGCTCTGCACGG - Intronic
968300000 3:197605299-197605321 TCACATACATGAGGTCAGCATGG + Intergenic
970162104 4:13199284-13199306 TCATACCCATGGGTTCTGCAGGG - Intergenic
970524271 4:16915495-16915517 TCAGATACATGGGCATTCCATGG - Intergenic
971127768 4:23773152-23773174 TCACATACTTGGTCTTTTCAAGG + Intronic
972261672 4:37415168-37415190 TCCCATACATGCGTTCTTCAGGG - Intronic
972714405 4:41631624-41631646 TCACATACATGTTCCCCGCAGGG - Intronic
975273807 4:72470603-72470625 TCTCTTAAAGGGGCTCTGCAAGG + Intronic
975746760 4:77482453-77482475 CCACAAATCTGGGCTCTGCAAGG + Intergenic
976773345 4:88679275-88679297 ACACAGACATGGGCTCTGTGAGG - Intronic
979050253 4:115921228-115921250 CAACATACATGGGCTCCGCAAGG + Intergenic
981217800 4:142191590-142191612 TTTCAACCATGGGCTCTGCAGGG - Intronic
981422961 4:144572235-144572257 TCTCATCCATGGGCTCTACAAGG + Intergenic
981920639 4:150080459-150080481 GCACATACCTGGGTTCTGCCTGG - Intronic
983177170 4:164603587-164603609 TTACAGACATGGGCTCTATATGG + Intergenic
984819897 4:183872814-183872836 TCAGATACATGGACATTGCAGGG - Intronic
984878948 4:184393541-184393563 TCACATTCATGGGCGGTGCAAGG - Intronic
985433618 4:189905677-189905699 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
985871776 5:2563031-2563053 GCACAGACGTGGGTTCTGCACGG - Intergenic
985875506 5:2591214-2591236 TCACCCACATGGGCTCTGCTGGG - Intergenic
986115484 5:4769599-4769621 TCACACACAGGGACGCTGCATGG - Intergenic
987116999 5:14733674-14733696 TCATTTACATGGGCTTTGCTGGG + Intronic
987462064 5:18223710-18223732 TCACATAAATGTGCCCTGGATGG + Intergenic
989012213 5:36885742-36885764 CGACATCCGTGGGCTCTGCAAGG + Intronic
991954560 5:71980014-71980036 TCCTATACGTGGGTTCTGCAGGG + Intergenic
992263879 5:74998047-74998069 TCATATATGTGGGTTCTGCAGGG - Intergenic
992427719 5:76675256-76675278 TCACATACATGGGTTCCACAAGG + Intronic
992607072 5:78468985-78469007 TTGTATACATGGGTTCTGCAGGG - Intronic
993209503 5:84930414-84930436 TTACATACGTGGGGTCTGTAGGG + Intergenic
995744595 5:115390566-115390588 TCTCATCCATGGGCTGGGCAGGG + Intergenic
995860003 5:116630663-116630685 TCTGATACAAGGGCTCTGGATGG - Intergenic
998036913 5:138925311-138925333 TCTCATCCATGGGCTGGGCAGGG - Exonic
999649057 5:153747717-153747739 TCACGTAACTGGGCTCTGCAGGG - Intronic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003019010 6:2493833-2493855 TCACATAAATTGGCTGGGCACGG - Intergenic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1004839052 6:19561792-19561814 TAAGATAAATGGGCTCAGCATGG - Intergenic
1005836611 6:29714257-29714279 TCCCAAACCTGTGCTCTGCAGGG + Intergenic
1005897720 6:30192117-30192139 CCACATACAGGGCCTCTGGAGGG + Intronic
1007519928 6:42444088-42444110 TCCCAGCCATGGGGTCTGCATGG - Intronic
1012168770 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG + Intergenic
1015902509 6:138082505-138082527 TCTCATGCATGGGCTGAGCAAGG - Intergenic
1018562546 6:165117583-165117605 ACACACACATGGTTTCTGCATGG + Intergenic
1018628455 6:165802683-165802705 CCACACATATGGGGTCTGCAAGG + Intronic
1020444332 7:8253717-8253739 ATACATACATGGGTTCTGCAGGG + Intronic
1021056512 7:16054096-16054118 TCACACCACTGGGCTCTGCATGG - Intergenic
1021194751 7:17662927-17662949 TCACCTACATGTGCACTGCTGGG - Intergenic
1021366036 7:19778910-19778932 TTACATACATGTGCAGTGCAGGG - Intergenic
1022380367 7:29853574-29853596 TCTCACACAGGGGCCCTGCATGG + Intronic
1022438246 7:30410557-30410579 ACACATACAGTGGCTTTGCATGG - Intronic
1026134276 7:67645693-67645715 TCATAGACATTGGCTTTGCAAGG - Intergenic
1027663957 7:81021563-81021585 TCAGATACAGGGGCTCTGAGTGG + Intergenic
1028828702 7:95303583-95303605 GCTCCTACATGAGCTCTGCAAGG + Intronic
1028998020 7:97123156-97123178 TCACATACCTGGGCCTTTCAGGG - Intronic
1031009392 7:116509763-116509785 TCACCTCCTTGGGTTCTGCAGGG + Intergenic
1033289654 7:140072485-140072507 TCACATTCATAGGTTCTGGATGG - Intergenic
1037042290 8:14250935-14250957 TGACATACTTGGGCTAGGCATGG + Intronic
1037491204 8:19398604-19398626 ACAAATGCATGGGCTATGCATGG + Intergenic
1037844889 8:22274549-22274571 AGACATCCAAGGGCTCTGCATGG - Intergenic
1038009116 8:23459867-23459889 TCACATTCATGGGTTCTGGGTGG + Intergenic
1038268835 8:26058925-26058947 TCTCAGACATGGGCTGGGCATGG - Intergenic
1038416188 8:27397647-27397669 CCACCACCATGGGCTCTGCAGGG - Exonic
1039388683 8:37159421-37159443 TAACATCCATGTGCACTGCAAGG + Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1040127496 8:43754664-43754686 AAACATAAATGGGCTCTGAAAGG - Intergenic
1042390450 8:68228121-68228143 TTTCATACATTGGCTCTTCAGGG + Intronic
1042711262 8:71719956-71719978 TCACATTCATGGGTTCTGGGTGG + Intergenic
1045099549 8:98830338-98830360 TCACATTCATGCTATCTGCATGG - Intronic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1048212722 8:132468818-132468840 TCCCATACGTGGGCTCTGGCTGG - Intronic
1048914852 8:139172772-139172794 ATACATACATGGGTTCTGCAGGG - Intergenic
1049050000 8:140187234-140187256 TCATATACACAGGTTCTGCAAGG + Intronic
1049052385 8:140208909-140208931 TCATATGCAGGGGTTCTGCAGGG + Intronic
1049586152 8:143433270-143433292 TTTCATCCATGGGCTCTGTAAGG + Intergenic
1050383819 9:5062209-5062231 TTGCATATATGGGTTCTGCAGGG + Intronic
1052086606 9:24274704-24274726 TCACATATGTGGGTTATGCAGGG + Intergenic
1052435404 9:28421624-28421646 TCACATATGTGGGTTCTCCAGGG - Intronic
1052593187 9:30525317-30525339 TCACATTCATGTTCTCTGCTGGG - Intergenic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1053722733 9:40963795-40963817 TCCCTTCCAGGGGCTCTGCAAGG + Intergenic
1054343231 9:63888202-63888224 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1056732661 9:89179075-89179097 TCACACAGATGGGCTGAGCAGGG - Intergenic
1057067199 9:92066405-92066427 TCACATACGTCACCTCTGCAGGG - Intronic
1057730187 9:97601858-97601880 TCACATACGTGGGTTCTGTAGGG + Exonic
1058407301 9:104691343-104691365 TCCCAAACATGGGCCGTGCAGGG + Intergenic
1059124872 9:111674866-111674888 TCATATACACAGGTTCTGCAGGG - Intergenic
1059682373 9:116598334-116598356 ACACATACATGGGGTCTTCTGGG - Intronic
1060348605 9:122838083-122838105 TGACATCCATGGGCTCCACAAGG + Intergenic
1061841677 9:133362128-133362150 TCTCATCCATTGGCTCTGCAGGG - Exonic
1062580759 9:137228323-137228345 TTACCTGCATGGGCTCTGCTGGG - Exonic
1203452432 Un_GL000219v1:132181-132203 TCCCTTCCAGGGGCTCTGCAAGG - Intergenic
1187720173 X:22141836-22141858 TCCCATACATAGGCTTTGAAAGG + Intronic
1187931924 X:24301553-24301575 TCATATACTTGGGTTCTGCAGGG - Intergenic
1188728358 X:33613379-33613401 CCAGAAACATGGGCTCTGTAGGG - Intergenic
1189922290 X:45914421-45914443 TCATATACGTGGGTTCTGTAGGG + Intergenic
1190838731 X:54126448-54126470 TCATATACACAGGTTCTGCAGGG + Intronic
1194254928 X:91623984-91624006 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1194321983 X:92460203-92460225 CGACATCCATGGGCTCCGCAAGG + Intronic
1199474424 X:148230167-148230189 TGACATACATGGCCTATGTAAGG + Intergenic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic
1200238933 X:154483603-154483625 GGACACACATGGGCTATGCAAGG - Intergenic
1200573712 Y:4863587-4863609 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1200630150 Y:5573680-5573702 CGACATCCATGGGCTCCGCAAGG + Intronic