ID: 1093449608

View in Genome Browser
Species Human (GRCh38)
Location 12:19300002-19300024
Sequence CAGGTACACCATGCAGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093449608 Original CRISPR CAGGTACACCATGCAGAGAA CGG (reversed) Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
900633192 1:3649618-3649640 CAGGTACCCCAAGCAGATATGGG - Intronic
904312163 1:29635861-29635883 AAGATTCACCAGGCAGAGAACGG + Intergenic
905043946 1:34982043-34982065 CAGGAACCCCAGGCAGACAATGG + Exonic
906536914 1:46556104-46556126 CATGAAAACCAAGCAGAGAAAGG - Intergenic
907481361 1:54747659-54747681 CAGGTAGACCAGGCAGGGGAAGG - Intergenic
908774326 1:67625745-67625767 CAGGTACAGCTTCCAGAGCATGG - Intergenic
909278921 1:73723797-73723819 CAGAATCAACATGCAGAGAAGGG + Intergenic
916811812 1:168312615-168312637 CATGTACACAGTGCTGAGAAGGG - Intronic
917198274 1:172489403-172489425 GAGGTGCAGCATGCAGAGGAAGG - Intergenic
920493432 1:206437150-206437172 CAGGTACCCCCTGAAGAGACAGG - Intronic
920568488 1:206996653-206996675 AAAGTATACCATGAAGAGAAGGG + Intergenic
921297917 1:213722107-213722129 CATGTACTCCAGGCAGAAAAAGG + Intergenic
924188779 1:241525660-241525682 CAAGGACATCATCCAGAGAAAGG + Intergenic
1064092221 10:12394969-12394991 GAGGCACACCATGCTGAGATGGG - Intronic
1064534022 10:16340308-16340330 CTGGTACAGCATGCAGATACTGG - Intergenic
1066211784 10:33247374-33247396 CTGTTACAACTTGCAGAGAATGG - Intronic
1067667309 10:48289423-48289445 CAGGTACACTCTACAGAGTATGG + Intergenic
1068980488 10:63057762-63057784 CAGGTGCTCCCTGCAGAGCACGG + Intergenic
1069843008 10:71351681-71351703 GAGGATCACCATGCAGACAATGG - Exonic
1071166101 10:82809099-82809121 CACATGCACCATGCAAAGAAGGG + Intronic
1073296954 10:102446276-102446298 AAAGTTAACCATGCAGAGAAGGG - Intergenic
1073867685 10:107823910-107823932 CATGGACAGCATGCAGGGAAGGG - Intergenic
1074541382 10:114367936-114367958 AATGTACACCATGCACAGACAGG + Intronic
1076172080 10:128327543-128327565 CAGCCATACCTTGCAGAGAAAGG + Intergenic
1078135841 11:8650778-8650800 TAGGTTCACCAGGCAGATAAGGG + Intronic
1082182732 11:49140171-49140193 CAGGTACACCAATCAGACATAGG - Intergenic
1084605250 11:70168423-70168445 CAGAAACACCAAGCAGAGGAGGG - Intronic
1085310676 11:75514809-75514831 CATGAACAGCATACAGAGAAGGG + Intronic
1085342925 11:75745140-75745162 CAAGTACAGCATGCAAAGAGGGG - Intergenic
1086746290 11:90431444-90431466 CAGCAAGACCATTCAGAGAAAGG + Intergenic
1089567604 11:119380321-119380343 CCAGTCCACCAAGCAGAGAAAGG + Intronic
1090100169 11:123786780-123786802 GAGGTAAACAATGCAGAGAGAGG - Intergenic
1090359719 11:126163869-126163891 CCGGGAGACCAGGCAGAGAATGG + Intergenic
1092094535 12:5830470-5830492 CAGGTACAACATCCAGGAAAAGG - Exonic
1093449608 12:19300002-19300024 CAGGTACACCATGCAGAGAACGG - Intronic
1094861998 12:34477804-34477826 CAGGTACACCAATCAGACATAGG - Intergenic
1095248755 12:39954236-39954258 CAGGTAAACCAGGCAGACATTGG + Intronic
1095906209 12:47380683-47380705 CAGGTAAATCTTGGAGAGAACGG + Intergenic
1097144299 12:56929469-56929491 CAGGTTCTCCTTGCCGAGAATGG + Exonic
1097394567 12:59058061-59058083 CAGGTCCACCATGTACAAAATGG - Intergenic
1098559646 12:71857853-71857875 CAGTTACCACAGGCAGAGAAGGG - Intronic
1100263911 12:92957946-92957968 TAGGAACACCCTGAAGAGAAGGG - Intergenic
1103612163 12:122130400-122130422 CACGTACCCCGTGAAGAGAACGG - Intronic
1103916209 12:124376925-124376947 CAGGGACACTCAGCAGAGAAGGG + Intronic
1104839135 12:131812382-131812404 CAGGAAGGCCATGAAGAGAAAGG + Intergenic
1107415772 13:40198925-40198947 GAGGTATATCATGCAGAAAAAGG - Intergenic
1108495519 13:51020675-51020697 CAGGTACACCATGCACCACATGG + Intergenic
1109110015 13:58305094-58305116 AAGGTACACTAGGCAGAGCATGG + Intergenic
1110108391 13:71709790-71709812 AATGTACACCCTGCAGATAAGGG + Intronic
1111511386 13:89268307-89268329 CAGGTACACCCTGCTGAAATGGG + Intergenic
1112818489 13:103302052-103302074 TAGGTACAGCAAGCAGAGATGGG + Intergenic
1114129376 14:19772090-19772112 CAAGTTCCCCTTGCAGAGAAAGG - Intronic
1117024937 14:51609526-51609548 CAAATTCACCAGGCAGAGAAGGG + Intronic
1117211343 14:53503653-53503675 CAGGTAGACCAGGTAGACAAGGG + Intergenic
1118451863 14:65910302-65910324 CAGGGAAACCCTGCAGAGACTGG - Intergenic
1120101909 14:80454196-80454218 CAGTTACACCATCCATAAAATGG + Intergenic
1121037827 14:90721099-90721121 CCGGTAAACCATGCAGGGAGGGG + Intronic
1121822621 14:96983730-96983752 CATGCACACCATGCATGGAATGG - Intergenic
1122067947 14:99186525-99186547 AAAGTGCATCATGCAGAGAAGGG + Intronic
1122753796 14:103961034-103961056 CAGACACAGCATGCAGACAAAGG - Intronic
1123033682 14:105463116-105463138 CAGGCACACCATGCAGGCAGGGG - Intronic
1123482514 15:20645983-20646005 CAGTGACACCATGCACGGAAGGG + Intergenic
1124143198 15:27095863-27095885 CAGTTTCTGCATGCAGAGAAGGG - Intronic
1124237380 15:28002383-28002405 CACCTCCACCCTGCAGAGAAAGG - Intronic
1125204584 15:37138807-37138829 CAGGTTCACCATGAAGCTAATGG + Intergenic
1126569044 15:50130124-50130146 CAGGTAAACAAGGCAGGGAAAGG - Intronic
1126870121 15:52978503-52978525 CAGGTTCCACATGCAAAGAAGGG - Intergenic
1131778100 15:95823883-95823905 CAGGTAGACCAGGCAGATAAGGG - Intergenic
1131900004 15:97077513-97077535 GAGGTACACAAGGCAGAAAAGGG - Intergenic
1132189994 15:99846258-99846280 CAGGTACACAATGGAGAGGTAGG - Intergenic
1133142486 16:3757572-3757594 CAGGTACCACAGGCAGAGAGGGG + Intronic
1133221404 16:4320627-4320649 CAGGCAGACGATGCAGGGAAGGG - Intronic
1135571406 16:23552129-23552151 CAGGTAAGCCTGGCAGAGAAAGG - Exonic
1137083620 16:36096540-36096562 CAGGTACACCAATCAGACATAGG + Intergenic
1137472671 16:48775940-48775962 CAGGTACATCATATAGTGAAAGG - Intergenic
1137673015 16:50290476-50290498 CAGGAACGCCATGCCCAGAATGG - Exonic
1137779703 16:51087683-51087705 CAAGTACACCATGGTGAGATGGG - Intergenic
1137971974 16:52994689-52994711 CATGTACACTCTGCAGTGAATGG - Intergenic
1139685430 16:68599595-68599617 CAGTTTCTCCATGCAGAAAATGG - Intergenic
1141733028 16:85834929-85834951 GAGGGCCGCCATGCAGAGAAGGG + Intergenic
1142113737 16:88345666-88345688 CTGGCTCACCATGCAGGGAAGGG + Intergenic
1142191150 16:88718537-88718559 CAGAGACACCATGCTGAGCAAGG + Intronic
1142728014 17:1830374-1830396 CAGGTGGAAGATGCAGAGAAAGG - Intronic
1143032264 17:3974317-3974339 CAGGAACACCCTGCACAGAGCGG + Intergenic
1147558602 17:41495442-41495464 CAAGCACACCAAGGAGAGAAAGG - Intergenic
1152350021 17:79778980-79779002 CAGGTCCAGCATGCAGGGAGGGG - Intronic
1153766732 18:8382223-8382245 CAAGTAAACCATGTAGAAAATGG - Intronic
1153952036 18:10065723-10065745 TAGGTCCTCCATGCACAGAAGGG - Intergenic
1156645127 18:39151833-39151855 TAGCTACTCCATGCAGAGCAGGG + Intergenic
1160409122 18:78663079-78663101 CAGGGGCGCCATGCAGGGAAAGG + Intergenic
1160787642 19:908694-908716 CAGGTGCATCAGGCAGAGACCGG - Intronic
1160812265 19:1017946-1017968 CAGGTCCCCCATTCAGAGCAGGG + Intronic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
1164633693 19:29777814-29777836 CAGGGACACCTTGCAGCCAAGGG - Intergenic
926794194 2:16605550-16605572 AAGGTACCCCATGCAGGGCAAGG + Intronic
927067504 2:19488203-19488225 CAGGTACCAGAGGCAGAGAAAGG - Intergenic
928170371 2:28999395-28999417 CAGGGACACCATCCAGATTAAGG + Exonic
932021066 2:68087310-68087332 AAGGTGCACCATGAAAAGAAAGG - Intronic
932732019 2:74228062-74228084 CAGCTACCCCAGCCAGAGAAGGG - Intronic
932914026 2:75835488-75835510 CAGGTACACCAAACAGACATAGG - Intergenic
933054403 2:77643485-77643507 GAGGTTCCCCATGCAAAGAAAGG - Intergenic
935148499 2:100412996-100413018 CAAGGAAACAATGCAGAGAATGG - Intronic
937910195 2:127071932-127071954 CAGGAACACAAGGCAGAGAGGGG + Intronic
942604618 2:177677430-177677452 CAAGAAGTCCATGCAGAGAAGGG + Intronic
943105899 2:183545102-183545124 CAGGTACACCATTCAAACATAGG - Intergenic
946136240 2:217649585-217649607 CTAATACACCATGCATAGAAAGG + Intronic
1169619694 20:7491586-7491608 CAAGTACAACATGGAGAGATGGG + Intergenic
1171135150 20:22688859-22688881 CAGGAACAGCATGCACAGATGGG - Intergenic
1171420108 20:25012300-25012322 CAGATACACCATGGACAGAAGGG + Intronic
1172258900 20:33544363-33544385 CTGGTTGACCTTGCAGAGAAGGG - Intronic
1172262198 20:33577299-33577321 GAGGTATACCAAGAAGAGAAGGG + Intronic
1173618326 20:44417385-44417407 CTTGTACCCCCTGCAGAGAATGG + Intronic
1175672565 20:60918101-60918123 CAGGTACACACTGCAAGGAAAGG + Intergenic
1175761673 20:61565716-61565738 AAGATACACAATGCAGGGAAAGG + Intronic
1176733287 21:10521201-10521223 CAGGCACACCTTGCAGAGGAGGG + Intergenic
1177811777 21:25932305-25932327 TACGTACTCCATGCAGACAATGG + Intronic
1178779915 21:35592818-35592840 CAGGGAGCCCTTGCAGAGAATGG - Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180699083 22:17772077-17772099 CAGTTACACCATCTGGAGAATGG + Intronic
1181168050 22:20993774-20993796 CAGGCACAGCAGGCAGAGCAGGG - Intronic
1182000297 22:26914414-26914436 CAGGTGCACTATTCAGAGAGCGG - Intergenic
1182110073 22:27716923-27716945 CAGGTAGACCAGCCAGACAATGG - Intergenic
1183535726 22:38399244-38399266 CGGGCACACCTTGCAGAGGAGGG - Intergenic
1184407909 22:44310559-44310581 CAGGTATACCAAACATAGAAAGG + Intronic
1184716349 22:46284288-46284310 CAGGTACACCCTGCGGAGTTGGG - Intronic
1185423100 22:50746132-50746154 CAGGTACTCTATGCAGACCAGGG - Intergenic
954133596 3:48572036-48572058 CAGCTTCACCCTGCACAGAATGG + Exonic
955302789 3:57799031-57799053 CAGCTACATCATGCAGAGATGGG - Intronic
955504030 3:59613463-59613485 CAGGACCACCATGAAGAAAATGG - Intergenic
956125005 3:66002877-66002899 CAGGTACAACAAGCATAGTAAGG + Intronic
957871442 3:86094459-86094481 CAGGTACACCAGTCAGATATAGG - Intergenic
960440041 3:117675515-117675537 CAGGGGCACCATGCAGAAGAGGG + Intergenic
961361534 3:126371114-126371136 CAGGGGCTCCATGCAGAGAATGG + Intergenic
961881894 3:130067521-130067543 CATGCACACCATGCAGATCAAGG - Intergenic
962061298 3:131930361-131930383 CAGGGTGACCTTGCAGAGAAAGG + Intronic
964171855 3:153779895-153779917 GAGATACAGCACGCAGAGAAAGG - Intergenic
964857182 3:161159245-161159267 AAGGTGCACCATGCAGAGATAGG - Intronic
965228786 3:166025729-166025751 CAGGTACACCAATCAGACATAGG + Intergenic
967412904 3:189184786-189184808 GATGTACACCATGCAGGGGATGG - Intronic
967814269 3:193786071-193786093 CAGGTCCACCAGGCTTAGAAGGG - Intergenic
968178690 3:196573527-196573549 CAGGTACATCGAGGAGAGAAGGG + Intronic
968910582 4:3475363-3475385 CAGGTAGAGGAGGCAGAGAAGGG + Intronic
975246027 4:72121264-72121286 CAGGTACACCAGTCAAACAAAGG - Intronic
975780493 4:77834249-77834271 AAAGTACTCCATGAAGAGAAGGG - Intergenic
976370121 4:84278514-84278536 CACCAACAGCATGCAGAGAATGG + Intergenic
977026245 4:91822202-91822224 TAAGTACACCATGGAGAAAATGG + Intergenic
978080538 4:104585199-104585221 AAGGCACTCCATCCAGAGAAGGG + Intergenic
979381446 4:120011450-120011472 CACGTTCTCCATGCAGAGGAAGG - Intergenic
979917460 4:126453984-126454006 CAGCTAGACTATGTAGAGAAGGG - Intergenic
980022717 4:127728896-127728918 CAGGAACACCATGAAGTCAAAGG + Intergenic
980799512 4:137731535-137731557 CAGATACACAATACACAGAAAGG - Intergenic
981617051 4:146653401-146653423 CAAGTACACCATGCCTTGAATGG + Intergenic
981854567 4:149272643-149272665 CAGTGAAACCATGCTGAGAAGGG + Intergenic
982513892 4:156319800-156319822 CATGTATACCATGTTGAGAAGGG + Intergenic
982648435 4:158053595-158053617 CAGGTACAAATTGCAGAAAATGG + Intergenic
982733567 4:158981219-158981241 CAGGTACACCAAGCAAACATAGG - Intronic
983311289 4:166064457-166064479 CAGGGTCACCATTCATAGAATGG + Intronic
983419775 4:167502231-167502253 CAGGTGCTGCATGGAGAGAAAGG - Intergenic
984877915 4:184385819-184385841 CAGGTACTGGCTGCAGAGAATGG + Intergenic
985424992 4:189821261-189821283 CAGGTACATCATACTGAGACAGG - Intergenic
985424995 4:189821316-189821338 CAGGTACATCATACTGAGACAGG - Intergenic
987202781 5:15594168-15594190 CTGCTACACCATGCAATGAAAGG + Intronic
987637150 5:20558514-20558536 CAGGTACTGCATGCAGCGAAGGG + Intronic
987696381 5:21338885-21338907 CAAGTACAACATGCAGACTAAGG + Intergenic
988755820 5:34247661-34247683 CAAGTACAACATGCAGACTAAGG - Intergenic
988981196 5:36571000-36571022 CAGGTGCACCTAGCAGAGAAGGG - Intergenic
989320558 5:40129677-40129699 CAGGTACACCATTCAAACATAGG + Intergenic
990253884 5:53944899-53944921 AAGTTACACTATGCAGAGACAGG + Intronic
991087042 5:62657120-62657142 CAGGTACACCAATCAGACAGAGG - Intergenic
991089146 5:62677429-62677451 CAGGTACACCAATCAGACAGAGG + Intergenic
991411479 5:66349978-66350000 CAGAAACACAAAGCAGAGAAAGG + Intergenic
991744078 5:69713517-69713539 CAAGTACAACATGCAGACTAAGG - Intergenic
991753629 5:69841719-69841741 CAAGTACAACATGCAGACTAAGG + Intergenic
991795650 5:70293241-70293263 CAAGTACAACATGCAGACTAAGG - Intergenic
991803246 5:70398446-70398468 CAAGTACAACATGCAGACTAAGG + Intergenic
991823451 5:70588785-70588807 CAAGTACAACATGCAGACTAAGG - Intergenic
991832947 5:70716844-70716866 CAAGTACAACATGCAGACTAAGG + Intergenic
991888019 5:71292760-71292782 CAAGTACAACATGCAGACTAAGG - Intergenic
992239075 5:74746810-74746832 CAGGAACTCCAAGCAGAAAAGGG + Intronic
995467409 5:112465362-112465384 CAGGTACACCATTCAGATGCAGG + Intergenic
995692787 5:114845909-114845931 CAGGTACACCAATCAGACATAGG - Intergenic
996851523 5:127958413-127958435 GAGGTTCAGCATGCAGTGAAAGG - Intergenic
997578518 5:135002591-135002613 CAGGTACACCAATCAGACATAGG + Intronic
997621763 5:135303723-135303745 CAGGTAAAACATGGAGAAAATGG - Intronic
998411239 5:141913162-141913184 CATGTAGTACATGCAGAGAAGGG + Intergenic
1000936472 5:167307958-167307980 AAGCTGCACCAGGCAGAGAATGG - Intronic
1001266091 5:170275611-170275633 CAGGGACAGGATGCAGAGCAGGG + Intronic
1002420160 5:179141867-179141889 CAGGTACACCAGGCCAAGAATGG + Intronic
1002428664 5:179190783-179190805 CTGGGACCCCATGCACAGAATGG + Intronic
1005554466 6:26959473-26959495 CAAGTACAACATGCAGACTAAGG - Intergenic
1006303620 6:33206909-33206931 CTGGGAGACCAGGCAGAGAAAGG - Intergenic
1006456429 6:34134590-34134612 CAGCTACCCCAGGCAGAGCAGGG + Intronic
1006584946 6:35103370-35103392 AAGGTAGGCCATGAAGAGAAGGG + Intergenic
1008953124 6:57182559-57182581 GAGGTACAACATAAAGAGAAGGG + Intronic
1011180869 6:84618935-84618957 CAGTGACTCCCTGCAGAGAAGGG + Intergenic
1012487203 6:99735570-99735592 GAGGCACACCATGCAGAGTTAGG - Intergenic
1013850017 6:114503028-114503050 CAGGAACACCAACCAAAGAAGGG - Intergenic
1016058483 6:139603468-139603490 GAGTTACATGATGCAGAGAAAGG + Intergenic
1016168080 6:140972938-140972960 CAGGTACACCAATCAGACATAGG + Intergenic
1016340406 6:143055891-143055913 CAGGTAGACCATTCAGAGCAGGG + Intergenic
1018598306 6:165508451-165508473 CAGGTCCACCAAGAAGTGAATGG - Intronic
1018771148 6:166972570-166972592 GAGGGAAAACATGCAGAGAAAGG - Intergenic
1020509362 7:9033969-9033991 CAGGAATATCATGCAGAGAATGG - Intergenic
1021256916 7:18403706-18403728 CTGGTACACCATGGTGAGCAAGG + Intronic
1022567159 7:31415069-31415091 AAGGTCCACCAAGCAGAGAGGGG + Intergenic
1024095644 7:45980390-45980412 CAGGTAGACTATCCAGAGCATGG - Intergenic
1029792798 7:102863208-102863230 AAGGTACAAAATGCAGAGGAAGG - Intronic
1030651920 7:112125501-112125523 AATTTATACCATGCAGAGAACGG + Intronic
1034693103 7:153029659-153029681 CAGGGACACAAAGCAGAGAGGGG - Intergenic
1037656325 8:20887314-20887336 CAGGGACACCAAGGAGTGAACGG + Intergenic
1037813999 8:22102445-22102467 CTGCCACACCATGCAGAGCATGG - Intronic
1039351589 8:36769678-36769700 CATGTACACCAAGCAAGGAATGG + Intergenic
1039444299 8:37618646-37618668 CAGGTAGTCCAAGTAGAGAAAGG - Intergenic
1044854811 8:96464434-96464456 CAGGTCCACAAAGCAGAAAAGGG + Intergenic
1045302942 8:100929878-100929900 GAGGTGCACCAAGTAGAGAATGG + Intronic
1047820158 8:128510624-128510646 CAGGAAAAGCATGCAGGGAAAGG - Intergenic
1048373411 8:133800240-133800262 GAGGGACACCATTCAGGGAATGG + Intergenic
1056187771 9:84152698-84152720 TATGTACACCATGCAGATATTGG + Intergenic
1056302479 9:85256775-85256797 CAGGTACACCAATCAAACAACGG + Intergenic
1057175803 9:92998097-92998119 CAGGTACACCAATCAGACAGAGG + Intronic
1057178424 9:93016028-93016050 CAGGTGGGCCAAGCAGAGAAGGG - Intronic
1057248708 9:93481796-93481818 GAGGCTCACCATGCAGAAAAGGG - Intronic
1058404387 9:104655298-104655320 CAGTTTCACCATGCTGAGACTGG - Intergenic
1060984253 9:127810509-127810531 CAGTTTCCCCAAGCAGAGAAAGG - Intronic
1061276639 9:129572535-129572557 CAGGACCAACATGCAAAGAAAGG + Intergenic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1187238140 X:17487550-17487572 CGGGTACATCAGGGAGAGAAGGG - Intronic
1192699753 X:73456085-73456107 CAGATACAAAATGCAAAGAAAGG - Intergenic
1198076987 X:133203360-133203382 CAGGTACTCCAAGAAGGGAAGGG + Intergenic
1201639137 Y:16160138-16160160 CAGGCTCAGCAAGCAGAGAAAGG + Intergenic
1201663676 Y:16425189-16425211 CAGGCTCAGCAAGCAGAGAAAGG - Intergenic