ID: 1093452761

View in Genome Browser
Species Human (GRCh38)
Location 12:19334487-19334509
Sequence GCATTTCCACAAGGGAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093452755_1093452761 11 Left 1093452755 12:19334453-19334475 CCTCTGCAGTGCAGTTAAGCCTA 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1093452756_1093452761 -8 Left 1093452756 12:19334472-19334494 CCTACCCTGAACTCTGCATTTCC 0: 1
1: 0
2: 2
3: 40
4: 347
Right 1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093452761 Original CRISPR GCATTTCCACAAGGGAGCTT AGG Intronic
900814734 1:4834809-4834831 CCATTTCCAAGAGGGAGCCTTGG + Intergenic
905817713 1:40965005-40965027 GCATGTGCTCAAGGGAGCTGAGG + Intergenic
907950384 1:59177966-59177988 GCAATACCCCAAGGGAGCTTAGG + Intergenic
916320028 1:163493757-163493779 TCATTTCTACAGGGCAGCTTTGG - Intergenic
923541750 1:234893305-234893327 GCATACCCACAAGGGTGCTTAGG + Intergenic
1063135689 10:3214325-3214347 GCTTTACCACATGGGAGCTCAGG - Intergenic
1065125943 10:22574208-22574230 GCACTTCCCAAAGGAAGCTTAGG + Intronic
1067748640 10:48955778-48955800 GCATTTACCCAAGGAAGCCTTGG - Intronic
1069833808 10:71296386-71296408 TCAGTTCCAGAAGGGAGCTGAGG - Intronic
1070398758 10:76034628-76034650 GCGATCCCACAAGGGAGCTATGG + Intronic
1070960880 10:80499488-80499510 GGAATTCCACAGGGGGGCTTTGG - Intronic
1072993899 10:100226137-100226159 GCATTGCCTCAAGAGAGCTGTGG - Intronic
1074397670 10:113111937-113111959 GCATCTCCTCAAGGAAGTTTAGG - Intronic
1074653830 10:115558905-115558927 GCATCTGCAAAAGGGAGCTGGGG - Intronic
1077094629 11:794101-794123 GCATTACCGCAAAGCAGCTTAGG - Intronic
1082116960 11:48338891-48338913 CCATCTCCACAGGGGAGCCTTGG - Intergenic
1083438849 11:62662711-62662733 GCATTTGCACAAGGAAGCTGTGG + Intronic
1085809566 11:79667924-79667946 GCCTTCCCACAAGGGAGAGTTGG + Intergenic
1086718110 11:90087521-90087543 ACATTTCCACAGGGAAGTTTGGG - Intergenic
1092047661 12:5443430-5443452 GAATTTCCCCAGGGGAGTTTTGG + Intronic
1092960763 12:13594931-13594953 GCATTTCCGCTAGGCAGCTGTGG - Intronic
1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG + Intronic
1093976355 12:25426489-25426511 GCATTTCCAGATGGGCGCTGTGG + Intronic
1095726461 12:45458820-45458842 GCATTTCCAAAAGTGAATTTAGG - Intergenic
1097020752 12:56019269-56019291 TCATTTCCAAAATGGTGCTTGGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1107187468 13:37540931-37540953 GCATATCCACATGGGTGCCTGGG + Intergenic
1108357984 13:49644129-49644151 GCAATTCCAGCAGGGACCTTCGG - Intergenic
1111828267 13:93295984-93296006 CCATTACAAAAAGGGAGCTTGGG - Intronic
1113766112 13:112882034-112882056 GCATTCCCACACGGGACCTAGGG - Exonic
1114189564 14:20430157-20430179 GCATGTCCACCAGGGAGTTGCGG - Exonic
1116784768 14:49275460-49275482 GCCTTTGCACAAGGAAGCTTAGG - Intergenic
1120387838 14:83868095-83868117 GCACGTGCAAAAGGGAGCTTGGG + Intergenic
1121993507 14:98583817-98583839 TCATTTTCAAAAGGGAGCATGGG - Intergenic
1122291795 14:100684745-100684767 GCATTTTCACCAGGGGGCTTCGG - Intergenic
1123196591 14:106623016-106623038 GCATTTCCTCAAGGAGGATTAGG - Intergenic
1124685577 15:31779065-31779087 CCATTTCCACAGCAGAGCTTGGG + Intronic
1128726920 15:69994947-69994969 GCATTGCCCCAAGGGACCTGGGG - Intergenic
1129491263 15:75927938-75927960 GCATTACCAAACGGGTGCTTTGG - Intronic
1130938761 15:88490855-88490877 GCATTTTCACAAGGGTCCCTAGG - Intergenic
1132172345 15:99673113-99673135 GCATTTCCACATGTCAGGTTTGG + Intronic
1132399175 15:101494896-101494918 AAATTTCCACATGGGAGTTTAGG - Intronic
1134215355 16:12312973-12312995 GCATTGTCATAAAGGAGCTTCGG + Intronic
1136028452 16:27485272-27485294 GTAGTGCCACAAGGCAGCTTTGG - Intronic
1136691508 16:32034652-32034674 GCATTTCCTCAAGTGGGATTAGG + Intergenic
1136772810 16:32856879-32856901 GCATTTCCTCAAATGAGATTAGG + Intergenic
1136792097 16:32978217-32978239 GCATTTCCTCAAGTGGGATTAGG + Intergenic
1136877720 16:33875691-33875713 GCATTTCCTCAAGTGGGATTAGG - Intergenic
1136897804 16:34004640-34004662 GCATTTCCTCAAATGAGATTAGG - Intergenic
1137848529 16:51715243-51715265 GCATTGGCACCAGGGAGCATTGG + Intergenic
1138330960 16:56214902-56214924 GCATTTCTAGAAGGCAGCTGAGG - Intronic
1140511839 16:75514210-75514232 TCATTTCTACCAGGAAGCTTTGG - Intergenic
1203075235 16_KI270728v1_random:1118989-1119011 GCATTTCCTCAAGTGAGATTAGG + Intergenic
1203094306 16_KI270728v1_random:1239681-1239703 GCATTTCCTCAAGTGGGATTAGG + Intergenic
1144593269 17:16542935-16542957 GCATTTTTACAAGAAAGCTTTGG + Intergenic
1146892831 17:36517755-36517777 GCATTTGGAGAAGGGATCTTCGG + Intronic
1147659892 17:42111881-42111903 CCATTCCCAGAATGGAGCTTCGG - Exonic
1149527057 17:57364764-57364786 TCAATCCCAAAAGGGAGCTTGGG - Intronic
1151388129 17:73767881-73767903 ACAACTCCTCAAGGGAGCTTTGG + Intergenic
1157718013 18:49902507-49902529 GCAGTTCCTCAAGGAAGCTGTGG + Intronic
1160781900 19:881289-881311 GCAAATCAACAAGGGAGCCTGGG - Intronic
1161738012 19:6003465-6003487 GCATTTCCTGAAGGGCTCTTGGG - Intronic
1162013724 19:7832393-7832415 GAATATCCACAAGGAAGCCTGGG - Intronic
1163132622 19:15285071-15285093 GCTGTGCCACAAGGGAGCCTTGG + Intronic
1164107574 19:22122226-22122248 CCTTTTTCACAAAGGAGCTTTGG + Intergenic
1164830011 19:31313207-31313229 GCATTTCCACACCCGAGATTTGG + Intronic
1166877742 19:45907955-45907977 GAATTTCCTCAGGGAAGCTTCGG + Intergenic
1168329900 19:55561901-55561923 TCATATACACAAGGGAGATTTGG + Intergenic
925879340 2:8338946-8338968 GCATTTCCACGTGGTTGCTTTGG - Intergenic
926671355 2:15579797-15579819 GCTTTTCCACAAGAGAGGTAAGG + Intergenic
926702896 2:15815729-15815751 ACATTTGCACAGGGGGGCTTGGG - Intergenic
929594141 2:43165587-43165609 TCTTTGCCACAAGGGGGCTTTGG - Intergenic
930950924 2:57144074-57144096 GGCTTTCCCCATGGGAGCTTAGG - Intergenic
931970291 2:67578276-67578298 CCATCTCCACAAGGAACCTTGGG - Intergenic
940550330 2:155146522-155146544 TCTTTTCAACAAGGTAGCTTTGG + Intergenic
941775438 2:169388345-169388367 GCCTTCCCAAAAGGCAGCTTAGG - Intergenic
942188844 2:173451085-173451107 GTATTTCCACAAAGAAGGTTTGG + Intergenic
945816776 2:214614345-214614367 GCCTCTCCACAAGGCTGCTTGGG + Intergenic
947535023 2:230934809-230934831 GCAGGTCGGCAAGGGAGCTTTGG + Intronic
948007654 2:234623650-234623672 GCAGTTCCAAGAGGGAGCCTAGG + Intergenic
948310634 2:236983197-236983219 GCATTTCCAGATGGCTGCTTGGG + Intergenic
1169984611 20:11430098-11430120 GCATTTCCTCAAGACTGCTTCGG + Intergenic
1170672415 20:18446900-18446922 GCATTTGCATAAGGGATGTTGGG - Intronic
1172019720 20:31905446-31905468 GCACAGCCACAAGGGAGGTTTGG + Intronic
1173462094 20:43251300-43251322 GCAGTCCCACCAGGGAGCTCTGG - Intergenic
1176373660 21:6076926-6076948 GCTTTTCCTCCAGGGAGCTCAGG + Intergenic
1177312695 21:19418072-19418094 GCATTTCAACATATGAGCTTTGG - Intergenic
1179749817 21:43461317-43461339 GCTTTTCCTCCAGGGAGCTCAGG - Intergenic
1180038187 21:45261472-45261494 GGATTTCCACAAAGGGGTTTTGG - Intergenic
1181443341 22:22949898-22949920 TCATTTCCACCAGGGATATTTGG + Intergenic
1181475554 22:23165797-23165819 GCCTTGCCACATGGCAGCTTGGG + Intergenic
1181886376 22:26025230-26025252 CCATCACCTCAAGGGAGCTTTGG + Intronic
1185124156 22:48996108-48996130 GCATTTCAAAGACGGAGCTTTGG + Intergenic
950290132 3:11777359-11777381 GCATTTCCAAAAAGGAGTTGAGG + Intergenic
953747090 3:45583379-45583401 GCAATTCCACAGTGGACCTTGGG + Intronic
953808639 3:46093367-46093389 GCATTTCCTCATGGTAGTTTTGG + Intergenic
954519423 3:51211141-51211163 GCATTTCCACAAGGAGGGGTGGG + Intronic
954922993 3:54207825-54207847 GCATTTCCACAAGATTACTTTGG + Intronic
960214194 3:115010366-115010388 TGATGGCCACAAGGGAGCTTGGG + Intronic
961512089 3:127409409-127409431 ACATTTCCACCAGGGAGCAGAGG + Intergenic
967603245 3:191414327-191414349 GAATTTCCCCAAGGTAGCATGGG + Intergenic
967621723 3:191642220-191642242 GCTTTTCTACAAGGCAGCTGTGG - Intergenic
968752086 4:2395586-2395608 GGATGTCACCAAGGGAGCTTTGG - Intronic
970170494 4:13284398-13284420 TCATTTCCACATGGCTGCTTGGG + Intergenic
976270917 4:83229687-83229709 GCATTTCCCCAAAAGAGATTAGG - Intergenic
981067524 4:140500314-140500336 CCATTTCTACAAGGGAGCATGGG + Intergenic
981325195 4:143438369-143438391 ACATTTCCAGAAGGAACCTTGGG + Exonic
982104159 4:151997369-151997391 GCAGTTCCACAGCAGAGCTTTGG + Intergenic
994240081 5:97408587-97408609 GCAGTTGCACCCGGGAGCTTGGG + Intergenic
994390373 5:99185448-99185470 GCTTTGCCTCAAGGGAGGTTGGG + Intergenic
995849586 5:116531424-116531446 GCCTTTACACAAGGTAGATTGGG - Intronic
997248992 5:132374424-132374446 GCTTTTCCTCCAGGCAGCTTTGG - Intronic
999940251 5:156534539-156534561 GCATTTCCATATGGGAACTAGGG - Intronic
999950711 5:156647083-156647105 GCATTGCAATAAGAGAGCTTTGG + Intronic
1000118292 5:158173855-158173877 GTATTGCCACAAAGGAGCTGAGG + Intergenic
1003363671 6:5452479-5452501 GCATTTCCCAAAGGGACCCTGGG + Intronic
1006621576 6:35368442-35368464 GCATATTCACCAGGGAGTTTTGG + Intronic
1007520365 6:42447385-42447407 GCGTTGCCACAAGGGTGCTGTGG - Intronic
1007673299 6:43575115-43575137 GCATTTTAACAAGGGCACTTTGG - Intronic
1015019366 6:128453601-128453623 GCATTTCTATAGGGGAGTTTTGG - Intronic
1018098502 6:160415044-160415066 CTATTTCTCCAAGGGAGCTTTGG + Intronic
1018316284 6:162559514-162559536 GCATTTCTACAAGAAAGCTACGG + Intronic
1022059553 7:26778255-26778277 GTATTTCCCCAAGGGAGCCTAGG - Intronic
1024006520 7:45228349-45228371 GCATTGCCAAAAGGGACCTCTGG - Intergenic
1024233905 7:47383722-47383744 GGATTTCTGCAAGGGAGCCTGGG + Intronic
1024321110 7:48070608-48070630 GCATGTTCCCAAGGGTGCTTGGG + Intergenic
1025954396 7:66171251-66171273 GAATGTTCACAAGAGAGCTTTGG - Intergenic
1029138500 7:98392493-98392515 ACATTCCCAGAAGGGAGCTCTGG - Intronic
1030360747 7:108593128-108593150 GCCTTTCCACAGTGGAACTTAGG - Intergenic
1031716442 7:125114487-125114509 GCATTTCCACATAGAAGCTCAGG - Intergenic
1033366544 7:140676344-140676366 GCATTTCAACAAAGGAATTTTGG + Intronic
1038648268 8:29379393-29379415 GCACTTCCACATTGTAGCTTGGG - Intergenic
1039572434 8:38598423-38598445 GGAATAGCACAAGGGAGCTTTGG - Intergenic
1040721212 8:50326234-50326256 GCATTTCCAGAAGGCAGAATTGG - Intronic
1045286556 8:100796647-100796669 GCCTTTCCTCGAGGGAGCTTTGG + Intergenic
1045403256 8:101839645-101839667 GAATTTCCATATAGGAGCTTAGG - Intronic
1045746548 8:105429513-105429535 ACATTACCATAAGGAAGCTTGGG - Intronic
1047701274 8:127451758-127451780 ACAGTTCCACATGGGAGCTGGGG - Intergenic
1052581443 9:30360148-30360170 GGATTTCCAAAAGAGAGCTATGG + Intergenic
1052921331 9:33972426-33972448 CCTTTTCCTCAAAGGAGCTTAGG + Intronic
1053144090 9:35700153-35700175 GCATTTCCGTGAGGCAGCTTTGG - Intronic
1060678253 9:125536852-125536874 CCTTTTCCACAGGGCAGCTTAGG + Intronic
1060927274 9:127463691-127463713 GGATTTCCACATAGGAACTTGGG + Intronic
1061495680 9:130973061-130973083 GCACAGCCACAAGGGAGTTTAGG - Intergenic
1062137404 9:134936948-134936970 GAGTTTCCAAAAGGCAGCTTTGG - Intergenic
1189174270 X:38939111-38939133 TCATTACCACAAGGGAGGATGGG - Intergenic
1193860157 X:86655114-86655136 TCATTTCAACAAGGGAGATCAGG + Intronic
1194738460 X:97543201-97543223 GCTTCTCCAGAAGGGAGCTCAGG + Intronic
1194978440 X:100415756-100415778 GCATTTCCTCTGGGGAGCTGTGG - Intergenic
1199560024 X:149151990-149152012 GCTTTTCCATAAGGCAGCTGTGG + Intergenic