ID: 1093452761

View in Genome Browser
Species Human (GRCh38)
Location 12:19334487-19334509
Sequence GCATTTCCACAAGGGAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093452756_1093452761 -8 Left 1093452756 12:19334472-19334494 CCTACCCTGAACTCTGCATTTCC 0: 1
1: 0
2: 2
3: 40
4: 347
Right 1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1093452755_1093452761 11 Left 1093452755 12:19334453-19334475 CCTCTGCAGTGCAGTTAAGCCTA 0: 1
1: 0
2: 0
3: 14
4: 118
Right 1093452761 12:19334487-19334509 GCATTTCCACAAGGGAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093452761 Original CRISPR GCATTTCCACAAGGGAGCTT AGG Intronic