ID: 1093454234

View in Genome Browser
Species Human (GRCh38)
Location 12:19349165-19349187
Sequence CTGCTGTACTGGAGCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093454234 Original CRISPR CTGCTGTACTGGAGCAAACA TGG Intronic
901193140 1:7424526-7424548 TTGCTGCATGGGAGCAAACAGGG + Intronic
906802953 1:48753383-48753405 CTCCTGTACTGGAGACAACCTGG - Intronic
908143152 1:61209035-61209057 CTGCTGTACTGGAGTAGCCCTGG + Intronic
910634407 1:89391040-89391062 CTGCTGGACTTGAGCATGCAAGG + Intergenic
912803438 1:112736567-112736589 TTTCTTTACTGGAGCAAAGATGG + Intergenic
914932305 1:151946029-151946051 CTGATGTACTGCAGGAACCAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917732256 1:177886482-177886504 CTGCTGTTCTGGGGCAAACTTGG - Intergenic
921336614 1:214093183-214093205 CTGCTGTACTGGAGGGGCCAAGG - Intergenic
923227709 1:231954660-231954682 CTGCTCTACTGGACCTAAAATGG + Intronic
924580911 1:245323803-245323825 CAGCTGTACGGGAATAAACAGGG + Intronic
924776123 1:247115301-247115323 CTGCTGGAGTGGAGCAGGCAAGG + Intergenic
1065712165 10:28529213-28529235 TTGGTATACTGGAGAAAACAGGG + Intergenic
1069264733 10:66443522-66443544 CTGCTGTTCTGCAGCCACCACGG + Intronic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079755349 11:24252377-24252399 ATGCTGAACTGGAGAAAGCATGG + Intergenic
1081151010 11:39632327-39632349 CTGCTCTACTGGTGAAAACAGGG - Intergenic
1087075654 11:94125196-94125218 CTGCTGGATAGGAGCAAAGAAGG - Intergenic
1087785414 11:102348205-102348227 CTGCTGTACTGCTGCTGACAGGG + Intronic
1088833405 11:113557208-113557230 CTGCTCTGCTGGAGCAGTCACGG - Intergenic
1090329989 11:125923934-125923956 CTGCTCTCCGGGAGAAAACATGG - Intergenic
1093454234 12:19349165-19349187 CTGCTGTACTGGAGCAAACATGG + Intronic
1093831214 12:23760813-23760835 CTACTGCACTGGAGCAAATGTGG - Intronic
1094594644 12:31854083-31854105 ATACTCCACTGGAGCAAACAAGG + Intergenic
1095985440 12:47996127-47996149 CTGCTGTCCAGGAGAAAGCAAGG - Intronic
1096752202 12:53767901-53767923 CTGCTGCAATGCAGCAATCATGG + Intergenic
1101788758 12:107909960-107909982 CTCCTGGCCTGGGGCAAACAAGG - Intergenic
1102215236 12:111156555-111156577 CTGATGCACTGGTCCAAACATGG + Intronic
1109536972 13:63734840-63734862 CTGCCATACTGGAGCAACCTGGG + Intergenic
1110782089 13:79478349-79478371 CTGCAGTACTGGAGTAGACATGG - Intergenic
1116206491 14:41874095-41874117 CTGCTATATTGGAAGAAACAGGG + Intronic
1117081441 14:52156105-52156127 CTGCTGTACTGGAGCCTGCCCGG - Intergenic
1118582626 14:67318475-67318497 CTACTGTACTGTAGAAAACGTGG + Intronic
1119223225 14:72925920-72925942 CAGCAGTACTGGAGCCAACACGG + Intergenic
1121497478 14:94404218-94404240 CAGCTGTACAGAAGCACACATGG + Intergenic
1121931948 14:97980174-97980196 ATGCTTTCCTGGAGCAAAAAGGG + Intergenic
1122411985 14:101530190-101530212 CAGTTGTCCTGGAGCAAGCACGG + Intergenic
1122417931 14:101559322-101559344 CTGATGGAGGGGAGCAAACAAGG + Intergenic
1125734860 15:41917781-41917803 TTGCAGAACTGGAGCAAAAATGG + Intronic
1130235322 15:82127977-82127999 CTGCTGTAGTGCATCACACAAGG - Intergenic
1132136771 15:99349301-99349323 TTGGTGTACTGGAGTAAAAATGG + Intronic
1136066818 16:27765064-27765086 CTGCTGTACTGGGAGAAACTTGG - Intronic
1136700453 16:32134208-32134230 CTGTTGTACAGCAACAAACATGG + Intergenic
1136767202 16:32793257-32793279 CTGTTGTACAGCAACAAACATGG - Intergenic
1136800946 16:33077444-33077466 CTGTTGTACAGCAACAAACATGG + Intergenic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1143428146 17:6856778-6856800 CAAATGTACTGGAGCAAAGAAGG + Intergenic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1146203806 17:30884052-30884074 CTACTGGACAGGAGGAAACAGGG - Intronic
1146515346 17:33484961-33484983 CTGCTCTGCAGGAGCAATCATGG + Intronic
1148529501 17:48376007-48376029 CTTGTGTATTGGAGAAAACAAGG + Intronic
1148963799 17:51417413-51417435 CTGGTGACCTGGATCAAACAGGG + Intergenic
1149904264 17:60510663-60510685 CTGGTGTAGTGGAGCAATTATGG - Intronic
1149965357 17:61157442-61157464 CTGCTCTTCTGCAACAAACAAGG - Intronic
1150763384 17:67983251-67983273 CTGCTGTCCTGGAGAAATCCAGG - Intronic
1151209331 17:72532647-72532669 CTGCTGAACTCGAGGAACCATGG + Intergenic
1152065526 17:78110701-78110723 CTGCTCTCATCGAGCAAACATGG + Exonic
1152371641 17:79892042-79892064 CTGCTTTCCTGGAGCAAATGTGG + Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1156807538 18:41203666-41203688 CTGCTGAAATGGATCAGACATGG + Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164925326 19:32125572-32125594 TTGCTGTAATGGAGCAGAGATGG - Intergenic
1164992430 19:32693922-32693944 CTGCTGGACAGGGGCAAAGAAGG + Intronic
1166743505 19:45128861-45128883 CTGCTGTCCTGGAGCAGTGAGGG - Intronic
925793978 2:7523142-7523164 ATGAGGTACTGAAGCAAACACGG + Intergenic
928287794 2:30008595-30008617 CTCCTGTACTGGAGCTGACCAGG + Intergenic
928626774 2:33147903-33147925 CTGTTCCACTGGAGCAAAAAAGG - Intronic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931643998 2:64405143-64405165 CTGCTCTACAGGAGCAGTCATGG + Intergenic
932266099 2:70368103-70368125 CTGCTCTGCAGGAGCAATCACGG + Intergenic
932654526 2:73598266-73598288 CTTATGTACTAGAGAAAACAAGG + Intronic
936075351 2:109398187-109398209 CTGCTGTCATGGAGCATGCAGGG + Intronic
936949068 2:117958980-117959002 CTGATGTTCTGGAGTTAACAGGG + Intronic
938805602 2:134804571-134804593 CTGCTGAATAGGAGCAAAGAAGG + Intergenic
939546591 2:143561856-143561878 CTTCTCTACTTGTGCAAACAAGG + Intronic
941991165 2:171559040-171559062 CTGCTCTACAGGAGCAGTCATGG - Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
946777264 2:223156448-223156470 CTGCTGTACTAATGCAGACAAGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
946999901 2:225442167-225442189 CTCCTGTATTGGAACAAATACGG - Intronic
1169609445 20:7362651-7362673 CAGCTGTACTGGAACAAAAAAGG - Intergenic
1170920875 20:20678430-20678452 CTGTTCTACAGGAGCAATCAGGG + Intronic
1173484528 20:43430690-43430712 CTGCTGTGCAGGAGCAGTCACGG + Intergenic
1173985036 20:47254610-47254632 CTGCTGTAGGGGAGCCAAGAAGG + Intronic
1174467514 20:50729704-50729726 CTGCTGTGCTAGTCCAAACAGGG + Intergenic
1175412506 20:58779971-58779993 CTGCTTCACAGGAGCAAGCAGGG + Intergenic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1178446238 21:32646270-32646292 ATTCTGTACCGGAGAAAACAGGG + Intronic
1178970046 21:37166232-37166254 CTGGTGTACTGGGGCAAACCTGG - Exonic
1179553701 21:42159557-42159579 CTGCTGTATTGAAGCCAAAACGG - Intergenic
1181064910 22:20300923-20300945 CTGCTGTGCTTGTGCACACAAGG + Intergenic
1185152237 22:49170607-49170629 CTGCTGGACAGGAGCAGCCATGG - Intergenic
949737220 3:7187584-7187606 CTGCTCTGCAGGAGCAATCACGG - Intronic
951816252 3:26758421-26758443 GTGATGTCCTGGAGCAGACAAGG + Intergenic
955186322 3:56718661-56718683 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
956696681 3:71924457-71924479 CTGCTGGACAGGAGCAGTCATGG - Intergenic
959794822 3:110413381-110413403 CTGCTGTGCTGCTGCAGACATGG + Intergenic
960717783 3:120594537-120594559 CTGCTCTACAGGAGCAGTCACGG + Intergenic
960949509 3:122990061-122990083 CTGCTGAAATGGATCACACAAGG + Intronic
961232862 3:125334847-125334869 CTGCTGGAGTGGAGTGAACAAGG - Intronic
962076905 3:132091471-132091493 ATGCTGAACTGTAGGAAACATGG + Intronic
964377003 3:156057641-156057663 CTGCTGTACTGGAACACATATGG + Intronic
968741441 4:2333462-2333484 CGCCTGTACTCGGGCAAACACGG + Intronic
969426010 4:7124384-7124406 CTGCTCTGCGGGAGCAGACACGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
974318832 4:60317300-60317322 CTGCTGTAATAGAGTAGACAAGG - Intergenic
975795416 4:78001661-78001683 CTGCTGGACAGGAACAAATACGG - Intergenic
977803316 4:101265165-101265187 CTGCAGTAGTGGTGCAAACAGGG + Intronic
977968058 4:103178495-103178517 CTCTTGAATTGGAGCAAACATGG - Intronic
978453480 4:108862535-108862557 CTGCTGTAATAGGGGAAACAAGG - Exonic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
983120782 4:163881850-163881872 CTGTTGTACATGAGCAGACACGG + Intronic
984147339 4:176079312-176079334 CTGCAGTGCTGCAGTAAACATGG + Intronic
985175533 4:187195831-187195853 CTGCTGTAATGGATCTCACAGGG - Intergenic
987362034 5:17116182-17116204 CTGCTCTATTGCAGCAAAGAAGG + Intronic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
989437651 5:41433583-41433605 CTCCTGTGCCTGAGCAAACATGG - Intronic
992012370 5:72541546-72541568 CAGCTGGCCTGGAGAAAACATGG - Intergenic
992952474 5:81874060-81874082 CTGCTGTCCCAGAACAAACAAGG + Intergenic
992965664 5:81997272-81997294 CTGCTGCACTGGAGGAGCCAAGG - Intronic
995488074 5:112659091-112659113 CTGCTGCACTGGAGGAGCCAAGG - Intergenic
996464412 5:123782892-123782914 TTGCTGAACTGGAGAAAACTGGG + Intergenic
998786270 5:145712112-145712134 CTGGTGTGCTGGAGCCATCAAGG + Intronic
1001081872 5:168673115-168673137 TTTCTGTACTGGAGCACAGAGGG + Intronic
1001189879 5:169620049-169620071 CTGGTGTGCTGGAGCCAAGATGG + Intergenic
1002252838 5:177940035-177940057 CCGGTGTCCTGAAGCAAACAGGG + Intergenic
1002929854 6:1625483-1625505 CTGCTCCACTCGAGGAAACAAGG + Intronic
1003914623 6:10775157-10775179 CTGCTCTGCTGGAGCAGTCATGG - Intronic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1007697171 6:43741088-43741110 CTGCTGGAATGGAGCAATGAAGG + Intergenic
1008154591 6:47998052-47998074 CTGCAGTACTGAATCAAGCAAGG - Intronic
1008569535 6:52802865-52802887 CTTCTGTACAGGAGCTAAAAAGG - Intronic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1012440976 6:99262061-99262083 CTGCTGGACAGGGGCAAAGAAGG + Intergenic
1013543982 6:111137655-111137677 CTGCTGAACTGGTGCAACTAAGG - Intronic
1013888865 6:115001749-115001771 CTGCTGAACTGGGGCACAGAAGG - Intergenic
1016068464 6:139708476-139708498 CTGCTGGACTGGAGCCAATCTGG - Intergenic
1016125528 6:140397838-140397860 CTGCAGGGCTGCAGCAAACATGG + Intergenic
1016184596 6:141183253-141183275 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
1016217062 6:141617312-141617334 GTGCTGTATTACAGCAAACAGGG + Intergenic
1019254975 7:43834-43856 CTGTTGTAAAGGAGCAGACAGGG + Intergenic
1020153043 7:5698257-5698279 CAGTTGTACTGGAGCAAGGAGGG + Intronic
1022127706 7:27374253-27374275 CTGCTGAAGTGCAGCTAACAGGG - Intergenic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1032436479 7:131905132-131905154 CTGCTGTGCAGGAGCAGTCACGG + Intergenic
1032800568 7:135314301-135314323 CTGCTCTACTGGGGAAAAAAAGG - Intergenic
1032836273 7:135677804-135677826 ATACTGTACTGGAGCAAATGAGG + Intronic
1039078376 8:33712687-33712709 CTGCTGTTCTGAAGCAGACAGGG - Intergenic
1043515521 8:80991425-80991447 CTGATGTTCTGGAGCACGCACGG + Intronic
1045293503 8:100853156-100853178 CTGCTGTTCTGCAGCCACCACGG + Intergenic
1045501109 8:102745122-102745144 CTGCTGGCCTGGAGCAGCCAGGG + Intergenic
1047132383 8:122035938-122035960 CTGTTGTACTGGACCATTCATGG - Intergenic
1050817386 9:9833010-9833032 ATGCTTTACTGGAGCCAAAATGG + Intronic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052914512 9:33914313-33914335 CTCCTGTATTTTAGCAAACATGG - Intronic
1055607191 9:77983101-77983123 CTGCTGTACTGGGGTAGAAAGGG + Intronic
1055740226 9:79380222-79380244 CTGGTGTAGGGGAGTAAACAAGG - Intergenic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1056509056 9:87285439-87285461 CTCCTGGGCTGGAGCAAACACGG - Intergenic
1059420549 9:114188104-114188126 CTGCTGTGCCGGAGCAGTCACGG - Intronic
1192924651 X:75742875-75742897 CTGGTGTACTGGGGCAAACCTGG + Intergenic
1192934733 X:75848056-75848078 CTGCTGCACTGGAGGGACCATGG + Intergenic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1193291355 X:79776992-79777014 ATTCTGCACTGGAGGAAACAAGG + Intergenic
1193742774 X:85238260-85238282 GAGCAGTACTGCAGCAAACATGG - Intergenic
1195267905 X:103201311-103201333 CTGCTCTGCTGGGGCAATCATGG + Intergenic
1195698291 X:107682962-107682984 CTGATTTAGTGGAGCAGACATGG - Intergenic
1196365313 X:114916921-114916943 TTGCTGTACTGTAGCCTACAGGG + Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1200096577 X:153667402-153667424 CTGCTGTTCTGGGCCACACAGGG - Intergenic
1201460408 Y:14216297-14216319 CTGCTGAACTGCAGAAAACAAGG - Intergenic
1201556237 Y:15267025-15267047 CTGCTGGATAGGGGCAAACAAGG - Intergenic
1201743587 Y:17348156-17348178 CTGCTGGACAGGAGCAAAGAAGG + Intergenic