ID: 1093456761

View in Genome Browser
Species Human (GRCh38)
Location 12:19372433-19372455
Sequence ACTAATATCCAGAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11054
Summary {0: 1, 1: 42, 2: 1021, 3: 4375, 4: 5615}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093456761_1093456765 28 Left 1093456761 12:19372433-19372455 CCTTCCAGATTCTGGATATTAGT 0: 1
1: 42
2: 1021
3: 4375
4: 5615
Right 1093456765 12:19372484-19372506 TTTCCTCCCATCCTGTTTTCTGG 0: 1
1: 0
2: 4
3: 61
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093456761 Original CRISPR ACTAATATCCAGAATCTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr