ID: 1093458686

View in Genome Browser
Species Human (GRCh38)
Location 12:19388860-19388882
Sequence ATACACTCTTTGGCTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093458686_1093458690 28 Left 1093458686 12:19388860-19388882 CCACTTTTAGCCAAAGAGTGTAT No data
Right 1093458690 12:19388911-19388933 TGAGGCTCCTAGATAGGCTCTGG No data
1093458686_1093458688 10 Left 1093458686 12:19388860-19388882 CCACTTTTAGCCAAAGAGTGTAT No data
Right 1093458688 12:19388893-19388915 AATGAGAAGACTCGTAGCTGAGG No data
1093458686_1093458689 22 Left 1093458686 12:19388860-19388882 CCACTTTTAGCCAAAGAGTGTAT No data
Right 1093458689 12:19388905-19388927 CGTAGCTGAGGCTCCTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093458686 Original CRISPR ATACACTCTTTGGCTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr