ID: 1093459499

View in Genome Browser
Species Human (GRCh38)
Location 12:19395547-19395569
Sequence ATTGCTGCACAACTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093459499_1093459505 15 Left 1093459499 12:19395547-19395569 CCCTGCTCCAGTTGTGCAGCAAT No data
Right 1093459505 12:19395585-19395607 ATTCTTTCTCTCTTCCTACCAGG No data
1093459499_1093459506 16 Left 1093459499 12:19395547-19395569 CCCTGCTCCAGTTGTGCAGCAAT No data
Right 1093459506 12:19395586-19395608 TTCTTTCTCTCTTCCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093459499 Original CRISPR ATTGCTGCACAACTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr