ID: 1093461101

View in Genome Browser
Species Human (GRCh38)
Location 12:19407596-19407618
Sequence AAGAAAAAAGAGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3617
Summary {0: 1, 1: 1, 2: 35, 3: 451, 4: 3129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093461101_1093461107 13 Left 1093461101 12:19407596-19407618 CCAGCCTCCATCTCTTTTTTCTT 0: 1
1: 1
2: 35
3: 451
4: 3129
Right 1093461107 12:19407632-19407654 TCTTACTATGTTGCCCAGGCTGG 0: 817
1: 18742
2: 91079
3: 193228
4: 377151
1093461101_1093461106 9 Left 1093461101 12:19407596-19407618 CCAGCCTCCATCTCTTTTTTCTT 0: 1
1: 1
2: 35
3: 451
4: 3129
Right 1093461106 12:19407628-19407650 AGGGTCTTACTATGTTGCCCAGG 0: 288
1: 6368
2: 33014
3: 91485
4: 216710
1093461101_1093461110 27 Left 1093461101 12:19407596-19407618 CCAGCCTCCATCTCTTTTTTCTT 0: 1
1: 1
2: 35
3: 451
4: 3129
Right 1093461110 12:19407646-19407668 CCAGGCTGGTCCTGAACTCCTGG 0: 411
1: 18604
2: 39084
3: 58525
4: 52639
1093461101_1093461111 28 Left 1093461101 12:19407596-19407618 CCAGCCTCCATCTCTTTTTTCTT 0: 1
1: 1
2: 35
3: 451
4: 3129
Right 1093461111 12:19407647-19407669 CAGGCTGGTCCTGAACTCCTGGG 0: 236
1: 9507
2: 19315
3: 30000
4: 28132
1093461101_1093461105 -10 Left 1093461101 12:19407596-19407618 CCAGCCTCCATCTCTTTTTTCTT 0: 1
1: 1
2: 35
3: 451
4: 3129
Right 1093461105 12:19407609-19407631 CTTTTTTCTTTTTAGAGACAGGG 0: 14
1: 216
2: 3096
3: 26653
4: 47383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093461101 Original CRISPR AAGAAAAAAGAGATGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr