ID: 1093462090

View in Genome Browser
Species Human (GRCh38)
Location 12:19416143-19416165
Sequence CTGTCACTAAAGCTGGAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4462
Summary {0: 1, 1: 2, 2: 60, 3: 649, 4: 3750}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093462090 Original CRISPR CTGTCACTAAAGCTGGAGTA CGG (reversed) Intronic
Too many off-targets to display for this crispr