ID: 1093466643

View in Genome Browser
Species Human (GRCh38)
Location 12:19456357-19456379
Sequence ACAGCAGCGCGACCCAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093466641_1093466643 6 Left 1093466641 12:19456328-19456350 CCACTGCAACTGTCTGTCTCATA 0: 1
1: 12
2: 14
3: 29
4: 238
Right 1093466643 12:19456357-19456379 ACAGCAGCGCGACCCAGAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093466643 Original CRISPR ACAGCAGCGCGACCCAGAGG TGG Intronic
900314821 1:2051338-2051360 CCAGCAGCGCTGCCCCGAGGCGG - Intronic
900984792 1:6066917-6066939 ACAGCACCGGGAGCCAGATGGGG - Intronic
902070539 1:13731385-13731407 TCAGCAGGGAGACTCAGAGGAGG - Intronic
902304067 1:15524110-15524132 TCAGCAGGGCGTCCCAGAGCTGG + Exonic
903277075 1:22229045-22229067 CCTGAAGCGGGACCCAGAGGGGG + Intergenic
905253684 1:36666131-36666153 GCAGCAGAGGAACCCAGAGGAGG - Intergenic
911324067 1:96448184-96448206 ACAGTAAAGCGACCCAAAGGTGG - Intergenic
912431539 1:109630702-109630724 ACAGCATCGCCACCCAGGTGTGG + Exonic
912515062 1:110211946-110211968 GCAGCACCGCGACGCCGAGGAGG + Exonic
912800313 1:112715772-112715794 CCAGCAGCCCCATCCAGAGGTGG - Intergenic
919188927 1:194190213-194190235 ACAGCAAAGCCACCCAGAGGTGG - Intergenic
919277957 1:195445296-195445318 ACAGCTGAGAGACCCAGAGATGG + Intergenic
1065311011 10:24415936-24415958 ACAGCAGGGAGACCCAGGGAGGG + Intronic
1070437120 10:76404193-76404215 ACAGCAGTGGCACCCAGAGGCGG + Intronic
1077480169 11:2810884-2810906 ACAGCAGAGCGTCCTACAGGTGG - Intronic
1078618065 11:12883104-12883126 GCAGCAGCGAGACCCAGACTCGG + Exonic
1079128926 11:17736332-17736354 CCAGCACCGCGACGCCGAGGAGG + Exonic
1080169029 11:29276410-29276432 ACAGCAAAACAACCCAGAGGAGG - Intergenic
1083255431 11:61492538-61492560 ACAGCAGCAGGAGCCAGGGGTGG - Intergenic
1084591196 11:70091646-70091668 ACAGCAGATGGTCCCAGAGGTGG - Intronic
1085704583 11:78775235-78775257 AGAGCAGGGCTTCCCAGAGGGGG - Intronic
1088707259 11:112474949-112474971 GCAGCAGTGAGACCCAGAGAGGG - Intergenic
1089611451 11:119671720-119671742 ACAGAAGGGCTTCCCAGAGGTGG - Intronic
1093264967 12:16991915-16991937 ACAGCAAAGTGACCCAGAGGTGG - Intergenic
1093466643 12:19456357-19456379 ACAGCAGCGCGACCCAGAGGTGG + Intronic
1094839904 12:34338499-34338521 AGAGCAGCTGGACCCAGCGGGGG + Intergenic
1094840200 12:34339599-34339621 AGAGCGGCTCGACCCAGCGGCGG + Intergenic
1095569033 12:43660967-43660989 ACAGCAAAGCGACTCAGAGGTGG - Intergenic
1095672326 12:44876104-44876126 GCGGCAGCGCGGCCCGGAGGGGG + Intronic
1097221809 12:57455554-57455576 ACAGCAGCACCAGCCAGAGCTGG - Exonic
1098320614 12:69239819-69239841 TCGGCGGCGCGGCCCAGAGGCGG - Intronic
1098395214 12:70010324-70010346 AGAGCAGCCCTAGCCAGAGGGGG + Intergenic
1098819088 12:75207491-75207513 GCAGCACCGCGACGCCGAGGAGG - Exonic
1098898042 12:76084773-76084795 CCAGCAACGCGAGCGAGAGGCGG + Exonic
1100679283 12:96901152-96901174 ACAGCAAAACGACCCAGAGGAGG + Intergenic
1103013349 12:117475011-117475033 ACATCAGCAGCACCCAGAGGAGG - Intronic
1104676000 12:130712980-130713002 ACAGGAGCGTGGCCCAGTGGTGG + Intronic
1105845600 13:24291294-24291316 ACAGCAGCTCGGCTCAGAGCAGG + Intronic
1119786844 14:77320688-77320710 GCCGGAGGGCGACCCAGAGGAGG - Exonic
1120545720 14:85809030-85809052 ACAGCTGAGAGACCCATAGGTGG - Intergenic
1121608244 14:95257008-95257030 ACAGGAGGGGGACACAGAGGAGG + Intronic
1122725012 14:103744790-103744812 GCAGCAGCTCAGCCCAGAGGTGG - Intronic
1122799657 14:104223273-104223295 TCAGCAGAGTGACCCAGAGCGGG - Intergenic
1123895799 15:24828879-24828901 AGAGCAGCGTGGCCCAGGGGAGG + Intronic
1126865967 15:52937251-52937273 ACAGCAAAGCGATCCAGAGGTGG + Intergenic
1130226224 15:82060174-82060196 ACAGCACTGTGAGCCAGAGGGGG + Intergenic
1132210229 15:100016716-100016738 ACAGCTGAGAGACCCAGAGATGG - Intronic
1135881318 16:26260324-26260346 ACAGCAACGTGACCCAGCTGGGG - Intergenic
1141532703 16:84657815-84657837 CCAGCACCGCGACACAGTGGTGG - Exonic
1141994913 16:87630233-87630255 ACAGCAGCTGGCCCCAGAGGTGG - Intronic
1142961150 17:3553266-3553288 ACAGCAGGGAGACCATGAGGAGG - Intronic
1145039545 17:19567182-19567204 ACATCAGCGCGATCCCGATGGGG - Exonic
1147522756 17:41190152-41190174 ACAGCAGCTGGACCCACAGCAGG - Exonic
1147522762 17:41190182-41190204 ACAGCAGCTGGACCCACAGCTGG - Exonic
1147526293 17:41226920-41226942 ACAGCAGCTGGACCCACAGCAGG - Exonic
1147528479 17:41250145-41250167 ACAGCAGCTGGACACACAGGTGG - Exonic
1147530463 17:41271576-41271598 ACAGCAGCTGGACCCACAGCAGG - Intergenic
1148406918 17:47423886-47423908 ACAGCAGCTCGTCCCGGAGCAGG - Intronic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149564409 17:57630906-57630928 ACAGAAGGGGGACCCAGAGATGG + Intronic
1150005293 17:61465310-61465332 ACAGAGGCATGACCCAGAGGAGG + Intronic
1156088376 18:33436899-33436921 GCATCTGCGTGACCCAGAGGTGG + Intronic
1159902513 18:74060834-74060856 AGAGCAGGGCTACCCACAGGTGG - Intergenic
1160079862 18:75715073-75715095 ACAGCAGCTCCATCCAGAGTTGG + Intergenic
1161076879 19:2290129-2290151 ACAGCAGCACGAAGCAGAAGAGG + Exonic
1161409806 19:4110847-4110869 ACAGCAGCACGACTCACAGCAGG + Intronic
1164934388 19:32199814-32199836 ACAGCAGGGCCACCAAGTGGGGG - Intergenic
1165368285 19:35383921-35383943 GCAGCAAAGCAACCCAGAGGTGG - Intergenic
1166364743 19:42272743-42272765 ACTGCACCGTGAGCCAGAGGAGG + Intronic
1167578375 19:50328491-50328513 GCAGCATCGCGACGCTGAGGAGG - Exonic
925014865 2:515080-515102 ACAGCAGCAGAAGCCAGAGGTGG - Intergenic
925731389 2:6921711-6921733 AGAGCAGTGGGACCCACAGGAGG + Intronic
925959827 2:9003958-9003980 ACAGCTGCGCGACCCAATCGCGG + Intergenic
927092709 2:19724274-19724296 ACTGCAGCCAGATCCAGAGGCGG + Intergenic
933148806 2:78889784-78889806 ACAGCACACCTACCCAGAGGTGG + Intergenic
933157645 2:78993055-78993077 ACAGCAGCGCGTCTGAGGGGAGG - Intergenic
934534422 2:95121540-95121562 AGAGCTCCGCGACCCAGAGAGGG + Intronic
935384085 2:102483149-102483171 ACAGCAGCTCTACCCAGCAGAGG - Intronic
938405365 2:131029907-131029929 CCAGCAGGGGGACCCCGAGGGGG + Intronic
944985230 2:205168677-205168699 ATGGCAGAGCAACCCAGAGGAGG - Intronic
945657824 2:212646802-212646824 AAATCAGCGTGACCCAGAGTTGG + Intergenic
946013836 2:216588214-216588236 ACAGCACTGCAACCCTGAGGAGG - Intergenic
946196518 2:218035538-218035560 ACAGCAGTGGGACACAGTGGAGG - Intronic
946200797 2:218069702-218069724 ACAGCAGTGGGACACAGTGGAGG - Intronic
948075681 2:235163668-235163690 TCAGCAGAGTGACCCAGTGGAGG + Intergenic
948289648 2:236815832-236815854 ACAGCAGCACGCCCCAGAGGAGG - Intergenic
949022548 2:241749673-241749695 ACGGCAGTGGGACTCAGAGGGGG - Intronic
1171389599 20:24792884-24792906 CCAGCTGCCCTACCCAGAGGTGG - Intergenic
1177606861 21:23390862-23390884 ACAGCAAAGTGACCCAGAGGTGG - Intergenic
1181056730 22:20263771-20263793 ACAGCAGCCAGACCAGGAGGTGG - Intronic
1183270086 22:36856508-36856530 TCCGCAGCGCCACCTAGAGGAGG - Intergenic
1183667514 22:39254145-39254167 ACTGCAGCGGGCGCCAGAGGAGG - Intergenic
1185172118 22:49300165-49300187 ACATCAGAGAGTCCCAGAGGGGG + Intergenic
953748157 3:45590966-45590988 TCAGCAGAGAGACCCAGAGTGGG + Intronic
954077477 3:48191433-48191455 ACAGAAGCGCTACCCACAGTAGG + Intergenic
956295661 3:67710601-67710623 GCACCAGCACCACCCAGAGGAGG - Intergenic
961377110 3:126474725-126474747 ACAGCTGCGCTTCCCAAAGGTGG - Intronic
963782018 3:149495868-149495890 ACAGCAACATGACCCAGAGGAGG - Intronic
966832949 3:184026481-184026503 ACAGCAAAGCGACCCACAGGTGG + Intergenic
969494889 4:7520832-7520854 ACTGCAGCCCGACCCAGTGCAGG - Intronic
969699517 4:8760554-8760576 AGAGCAGCGTGTCCCAGATGGGG + Intergenic
971368429 4:25995689-25995711 TCAGCAGAGCATCCCAGAGGAGG - Intergenic
973552623 4:52051307-52051329 ACAGCCGCGCGCCCCAGGGGTGG - Intergenic
976224018 4:82781033-82781055 GCAGCAGGGCCCCCCAGAGGAGG + Intronic
978155563 4:105485946-105485968 ACAGCAAAGCGACCCAAAGGTGG - Intergenic
987099899 5:14582149-14582171 ACAGCGGCTCGACCCCGAGTGGG - Intronic
987107224 5:14652050-14652072 ACAGCAAAGCGACCCAAAGGTGG + Intergenic
996780366 5:127179855-127179877 ACAGCAAAGCAACGCAGAGGTGG + Intergenic
1001888104 5:175314176-175314198 ACAGCATGGTGACCCAGAGTTGG - Intergenic
1002512550 5:179732576-179732598 ACAGGAGCCCGTCCAAGAGGCGG - Intergenic
1002981238 6:2140943-2140965 ACAGGAGCACTTCCCAGAGGAGG - Intronic
1014547540 6:122750663-122750685 ACAGCAGTGGGGCCCAGGGGAGG - Intergenic
1017164145 6:151391501-151391523 GCAGCAGCGAGAGGCAGAGGCGG - Exonic
1020262311 7:6537115-6537137 ACAGCAGTCCAGCCCAGAGGGGG + Intronic
1020771653 7:12403497-12403519 ACAGCAGAGGGACAGAGAGGAGG + Intronic
1021616850 7:22510724-22510746 ACAGCAAAGCGACCCAAAGGTGG + Intronic
1028259202 7:88640288-88640310 ACAGCAAAGCAACCCAAAGGAGG - Intergenic
1029604419 7:101590123-101590145 ACAGCAGATAGACCCAGGGGAGG - Intergenic
1034263421 7:149770909-149770931 ACAGCAGAGCCACCCTCAGGAGG - Intronic
1035271751 7:157723990-157724012 ACACCAGCGCGATTCAGACGGGG - Intronic
1035271774 7:157724113-157724135 ACACCAGCGCGATTCAGATGGGG - Intronic
1037348328 8:17923223-17923245 AGGGCGGCGCGCCCCAGAGGCGG + Intronic
1039843248 8:41308506-41308528 CCAGCACCGGGACCCAGCGGCGG + Intronic
1041933790 8:63314957-63314979 ACAGCAGCCTGAACCTGAGGAGG - Intergenic
1044824348 8:96182384-96182406 ACAGCATGGCCACCCACAGGAGG - Intergenic
1046760213 8:118012603-118012625 ACAGCAGTGAGACGCAGAGCTGG - Intronic
1048882601 8:138883118-138883140 ACAGCAGCAGCATCCAGAGGAGG + Exonic
1049307250 8:141910634-141910656 AGAGCAGGGCTACCAAGAGGTGG + Intergenic
1052856685 9:33411295-33411317 ACAGCAGGGCTATACAGAGGCGG - Intergenic
1056569311 9:87802106-87802128 TCAGCAGCTGGACCCAGAGGTGG - Intergenic
1061784789 9:133020740-133020762 ACAGCAAAGCGACCCAAAGGTGG - Intergenic
1061871778 9:133524758-133524780 TCAGCATCGCGGCCAAGAGGCGG - Exonic
1062081000 9:134623321-134623343 TCATCAGTGCGGCCCAGAGGAGG - Intergenic
1187486520 X:19709282-19709304 ACAGGGGAGGGACCCAGAGGTGG + Intronic
1192260669 X:69504492-69504514 ACAGCGGTGCGAACGAGAGGCGG + Intergenic
1193820644 X:86160343-86160365 ACACCAAAGTGACCCAGAGGAGG + Intronic