ID: 1093467282

View in Genome Browser
Species Human (GRCh38)
Location 12:19462695-19462717
Sequence ATGTAGATGGTCAGCGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093467273_1093467282 30 Left 1093467273 12:19462642-19462664 CCAGGCTTGCTTCAACTCTAGCC 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1093467276_1093467282 8 Left 1093467276 12:19462664-19462686 CCAGATCTGGCAGATCACATCCG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 122
1093467275_1093467282 9 Left 1093467275 12:19462663-19462685 CCCAGATCTGGCAGATCACATCC 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093467282 Original CRISPR ATGTAGATGGTCAGCGAGGA GGG Exonic
902575016 1:17372240-17372262 CTGAGGATGGTCAGCGTGGAGGG + Exonic
903740783 1:25557259-25557281 CGGAAGATGGTCAGCGGGGAGGG + Exonic
908590106 1:65621939-65621961 ATGTGCCTGGTCAGGGAGGATGG + Intronic
911894107 1:103407155-103407177 ATGTAGATGGGCAGCCAAGAAGG + Intergenic
918004520 1:180529254-180529276 ATGAAGATGCTCAGAGAGGTTGG - Intergenic
920664041 1:207947115-207947137 ATATATATGGTCAGAGAAGAGGG - Intergenic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
1063654095 10:7969874-7969896 AAGCAGAGGGTCTGCGAGGATGG - Intronic
1071118216 10:82248503-82248525 ATGCAGATGGTCACCCAGCATGG - Intronic
1071752553 10:88496893-88496915 ATGGAGATGGTCAAAGAGTAGGG + Intronic
1074279765 10:112039824-112039846 AAGTGGATGGTCAGGGAGGCTGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1078526845 11:12107964-12107986 AGGAAGATGGTCAGCAAGGGTGG + Intronic
1079311548 11:19370957-19370979 ATGTAGAAGGTCAGAGATGGAGG + Intronic
1083956806 11:65988374-65988396 TGGTAGATGGGCAGCAAGGAGGG - Intergenic
1085917141 11:80903374-80903396 ATGCAGGTTGTCAGCGAGGTGGG - Intergenic
1086348741 11:85923972-85923994 GTGTAGGTGGTGAGTGAGGAGGG - Intergenic
1087336828 11:96854110-96854132 AGGTAGAGGGCCAGGGAGGAAGG + Intergenic
1087772822 11:102228924-102228946 ATCTAGATAATCAGAGAGGAGGG - Intronic
1088187463 11:107187703-107187725 ATGTGGATGGTCAGCTACTATGG - Intergenic
1089661502 11:119989050-119989072 ATGCAGATGGGTAGCGATGAGGG - Intergenic
1091794023 12:3287132-3287154 ATGAGGATGGTCAGCAGGGAAGG + Intergenic
1091802010 12:3330339-3330361 CTGCAGATGGGCAGCTAGGAGGG + Intergenic
1093128064 12:15354164-15354186 ATGTAGATGGTCTGCCACAATGG + Intronic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1093497187 12:19771730-19771752 ATGTTGGTGGTTAGGGAGGAAGG + Intergenic
1096542051 12:52313418-52313440 ATGAAGAGGGCCAGCAAGGAAGG + Intergenic
1097756565 12:63413588-63413610 CTGTACATGGTGAGAGAGGAAGG + Intergenic
1102253062 12:111400586-111400608 ATGGAGATGGTCAGCAATGGGGG + Intergenic
1104072323 12:125356602-125356624 CTGTAGATGTCCAGCCAGGAGGG - Intronic
1108820015 13:54336904-54336926 ATGTAGATGGTCAGAAGAGAAGG - Intergenic
1115299226 14:31865528-31865550 ATGTAGGTTGTCAGGGAGGTAGG - Intergenic
1117092935 14:52268367-52268389 ATCCAGATGGTCCACGAGGAGGG + Exonic
1119163009 14:72469049-72469071 ATGAGGATGGGCGGCGAGGAGGG - Intronic
1126544563 15:49858778-49858800 ATCTAAATAGTCAGTGAGGAAGG - Exonic
1129708915 15:77810381-77810403 AGGGAGAGGGACAGCGAGGAGGG + Intronic
1129912371 15:79239437-79239459 ATGCACAGGGTCAGGGAGGAAGG - Intergenic
1130323831 15:82862908-82862930 ATGTCGGTGCTCAGAGAGGAGGG - Intronic
1131326862 15:91456275-91456297 ATGTAGGTTGTCAGGGAGGTCGG + Intergenic
1133803406 16:9103710-9103732 CTGTAGATGGTGGGAGAGGATGG + Intronic
1134089705 16:11384953-11384975 ATTGAGCTGGCCAGCGAGGACGG - Exonic
1134653055 16:15925944-15925966 AAGTATCTGGTCAGCGGGGAAGG - Intergenic
1140138101 16:72226116-72226138 ATGTAGCTTGACAGAGAGGATGG - Intergenic
1140497873 16:75405952-75405974 ATGTAGATGGTCAGACATGGTGG + Intronic
1141046671 16:80721794-80721816 ATGGGGATGGTCACCGGGGAGGG - Intronic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1144666662 17:17106744-17106766 ATGTAGTTGGTCAGTTATGATGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1150269573 17:63854919-63854941 AGGTAGCTGGTCAGTGAGGAAGG + Intergenic
1151294214 17:73172100-73172122 ATGTATACAGTCAGTGAGGAAGG - Intergenic
1151724787 17:75877681-75877703 ATGGAGATGGGAAGGGAGGAAGG - Intronic
1155594639 18:27470984-27471006 ATGAAGATGGTAAGGCAGGAAGG + Intergenic
1156722189 18:40083806-40083828 ATGCAAATGGTTAGCAAGGAAGG + Intergenic
1157546112 18:48547614-48547636 GTGAAAATGGCCAGCGAGGAGGG - Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1163455473 19:17403666-17403688 AGGAAGCTGGTCAGTGAGGAGGG - Exonic
1165878465 19:39026177-39026199 ATGTGGTTGCTCAGGGAGGAGGG - Intronic
1166346712 19:42170930-42170952 AGATGGCTGGTCAGCGAGGAGGG - Intronic
928116432 2:28548376-28548398 AAGTAGCTGGGCAGCAAGGAGGG + Intronic
929589963 2:43138495-43138517 TTGTAGATTGTCTGCGAAGATGG + Intergenic
930579311 2:53190723-53190745 ATGTAGGTGGTCAGCTAATATGG - Intergenic
932097566 2:68865084-68865106 CTGTAGTTGCTCAGAGAGGAGGG - Intergenic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938765381 2:134457717-134457739 ATGAAGACTGTCAGAGAGGAAGG + Intronic
940653983 2:156466128-156466150 ATGTATATGGTAAGCAAAGAAGG + Intronic
946712575 2:222521638-222521660 AAGTAGCTGGTCAGAGAGAAAGG + Intronic
1172428654 20:34873006-34873028 GTGTAGATGGACAGCCAGGAAGG + Intronic
1174231892 20:49052383-49052405 ATGTAGATGGTAATCGTAGAAGG + Intronic
1181817350 22:25448477-25448499 ATATAGATGGGGAGAGAGGAAGG + Intergenic
1182252190 22:29009871-29009893 CTGGAGATGGTCAGTGATGATGG - Intronic
950279917 3:11697936-11697958 ATGCAGATGATCAGCAAGGCTGG - Intronic
951685231 3:25336614-25336636 ATGTTGTTGGGCAGAGAGGAAGG - Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956695656 3:71917085-71917107 AGGTAGCTGGTGAGCCAGGATGG + Intergenic
957440267 3:80237306-80237328 AGGTAGATGGTCACGGAAGAAGG + Intergenic
959568236 3:107854649-107854671 ATGGAGATGGTCAGCAAGGTGGG - Intergenic
963534710 3:146513170-146513192 AGGTAGGTGGTCAGTGAGGAAGG - Intergenic
963818465 3:149860588-149860610 TTGTATATGGTCAGAGATGAGGG - Intronic
965784555 3:172322167-172322189 ATCTAGAGTTTCAGCGAGGAGGG + Intronic
973212797 4:47635598-47635620 ATGTATTGGGTCAGAGAGGAAGG + Intronic
977601167 4:98935421-98935443 ATATAGATGGGCAGCCAAGAAGG + Intergenic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
988290415 5:29277060-29277082 AGGTAGATAATCAGCAAGGAAGG + Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
991650172 5:68844624-68844646 ATGCAGATCCTCAGAGAGGAAGG - Intergenic
994628888 5:102256499-102256521 AAGTAGGTGGTCAGGCAGGAGGG - Intronic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001549604 5:172593512-172593534 AGGCAGATGGCCAGCGAGGTGGG + Intergenic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007974538 6:46087025-46087047 ATGTGTATGGTGAGCTAGGATGG - Intergenic
1010631094 6:78199350-78199372 ATGTAGAGGGTCAGGGTGGGCGG - Intergenic
1012684322 6:102225407-102225429 ATGTAGATGGAGATCTAGGAGGG + Intergenic
1016278965 6:142390738-142390760 ATGCAGATGAGCAGCAAGGATGG - Intronic
1016355748 6:143216355-143216377 AGGTATATGGACAGGGAGGATGG + Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1019876057 7:3811751-3811773 GGGTAGATGGTCAGCAGGGATGG + Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1028874054 7:95800652-95800674 ATGTAGATGATCAGACAGGGAGG + Intronic
1031110796 7:117606136-117606158 ATGTAGATTGTCTGCGAAGAGGG + Intronic
1033196640 7:139333112-139333134 ATGTAGCTGGTCTGCCAGGCTGG + Intergenic
1034125816 7:148670677-148670699 ATGTCAGTGGTAAGCGAGGAAGG + Intergenic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1038963316 8:32546857-32546879 ATGTAGATGGGAAGGGAGGGAGG - Intronic
1042427741 8:68668735-68668757 CTGTTGATGGGCAGAGAGGAAGG + Intronic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1046743113 8:117849006-117849028 CTGTAGATGGTGACTGAGGATGG - Intronic
1047832273 8:128647764-128647786 ATGTAGGTGGGCAGGGAGGGAGG - Intergenic
1049163234 8:141111078-141111100 ATGTGTAGGGTCAGGGAGGACGG + Intergenic
1052851589 9:33381534-33381556 TTGTAGAAGGTTACCGAGGAAGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1061217152 9:129228137-129228159 ATGTAGATGGAAAGAGAGCAAGG - Intergenic
1061558967 9:131390396-131390418 ATGAGGATGGTCAGGGAGGTAGG + Intergenic
1062157201 9:135058782-135058804 ATGTAAATGGCCAGCTAGGGAGG + Intergenic
1186257612 X:7739803-7739825 AGGTAGATTCTCAGTGAGGATGG - Intergenic
1187062511 X:15800978-15801000 ATGTAGATGGCCAGGTAGAAAGG + Intronic
1190332476 X:49244369-49244391 ATATAGGTGGACAGCAAGGAAGG - Intronic
1190688482 X:52894614-52894636 TTGTTGGTGGTCATCGAGGAGGG + Intronic
1190697501 X:52961178-52961200 TTGTTGGTGGTCATCGAGGAGGG - Intronic
1195175650 X:102312986-102313008 ATGTACATGGACAGGAAGGAAGG + Intronic
1195183214 X:102374107-102374129 ATGTACATGGACAGGAAGGAAGG - Intronic
1195577372 X:106467149-106467171 AAGTAGGTGGTCAGGAAGGAAGG - Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199986738 X:152958213-152958235 ATGTTGATGGTAAGAAAGGAAGG + Intronic