ID: 1093467831

View in Genome Browser
Species Human (GRCh38)
Location 12:19468294-19468316
Sequence CTGGCCTATCTGACTTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093467827_1093467831 1 Left 1093467827 12:19468270-19468292 CCAGGCATATATCACCACACTCA 0: 1
1: 0
2: 1
3: 28
4: 240
Right 1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG 0: 1
1: 0
2: 0
3: 3
4: 94
1093467822_1093467831 30 Left 1093467822 12:19468241-19468263 CCATCTCAGCTTCTTGAGTTCCT 0: 1
1: 2
2: 41
3: 584
4: 6082
Right 1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG 0: 1
1: 0
2: 0
3: 3
4: 94
1093467826_1093467831 10 Left 1093467826 12:19468261-19468283 CCTGGGATTCCAGGCATATATCA 0: 1
1: 0
2: 4
3: 126
4: 1319
Right 1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG 0: 1
1: 0
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093467831 Original CRISPR CTGGCCTATCTGACTTTAGA TGG Intronic
900425625 1:2577214-2577236 CTGGCCTAGGTGACTTTTCATGG - Intergenic
901723001 1:11215428-11215450 CTGGACTATTTGATTTTAGCAGG - Intronic
905491845 1:38350533-38350555 CTGGTCTATGTGACCTTAGGTGG - Intergenic
917515853 1:175707541-175707563 TTGGCTGATCTGCCTTTAGAGGG + Intronic
918976224 1:191489927-191489949 GTGGCCTATCAGACAGTAGAGGG - Intergenic
922585344 1:226730176-226730198 CTGGTCCATCTGACTGTGGAGGG - Intronic
923502596 1:234578463-234578485 CTGGCCTATAGGACTCTACAAGG + Intergenic
1064651526 10:17514651-17514673 CTGGCCTATCTGGGTGTGGAGGG + Intergenic
1067344157 10:45425938-45425960 CTGGCCCACCTGAATCTAGAGGG + Intronic
1070117436 10:73542425-73542447 CTGGCCTATTGGACTTTAATTGG - Intronic
1070777420 10:79117983-79118005 CTGGCCTCCCTGACTGTTGAGGG - Intronic
1074197173 10:111199743-111199765 CTGTCCTATCTGAATATAGCTGG - Intergenic
1079501302 11:21104299-21104321 CTGGTATTTCTGACTTTTGAGGG - Intronic
1080777337 11:35398200-35398222 CTGGCCCCTCTCACTTTTGAAGG + Intronic
1088609370 11:111562696-111562718 CTGGCCAACCTGAGTTTTGAAGG - Intergenic
1090768003 11:129893989-129894011 ATGGCCAATCTGCCTTTAGTTGG + Intronic
1091356255 11:134940121-134940143 CAGGCCGCTCTGCCTTTAGAAGG + Intergenic
1092345537 12:7711673-7711695 CTTGACTATCTGACTATAGGGGG + Intronic
1093467831 12:19468294-19468316 CTGGCCTATCTGACTTTAGATGG + Intronic
1097467265 12:59942889-59942911 CAGGCCTCTCTGACATTAGTAGG + Intergenic
1100041285 12:90321216-90321238 CTGGCAAATTTAACTTTAGAAGG - Intergenic
1101862883 12:108497397-108497419 CTGGCTTTTCTGACTTTCAATGG - Intergenic
1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG + Intergenic
1102862264 12:116346200-116346222 CTGGTCCATCTGACTTCACATGG + Intergenic
1103125239 12:118416457-118416479 CTCTCCTCTCTGACTTTTGAGGG + Exonic
1108570554 13:51745568-51745590 CTGGGCTATCTGATTCTACAGGG - Intronic
1111825676 13:93264103-93264125 CTGGGCTTTCTAACTTCAGATGG + Intronic
1114590612 14:23861160-23861182 CTGGAGTATCTCACTTTAGTAGG + Intergenic
1115623621 14:35166745-35166767 CTGGCCTATCTGAATCTTTAAGG + Intronic
1117011303 14:51473278-51473300 ATGGCCTATCTTATTTTAAAAGG + Intergenic
1131178217 15:90223404-90223426 CTGCTCTTCCTGACTTTAGATGG + Intronic
1132238736 15:100241118-100241140 CTGGCCTATCTGGCTTTTTTTGG + Intronic
1134287294 16:12873170-12873192 ATGGTCTATCTGAATTAAGAAGG + Intergenic
1134328209 16:13226436-13226458 CTTGCCTATAGGACATTAGATGG + Intronic
1137389938 16:48072844-48072866 CTGCTCTGTCTGAATTTAGAGGG + Intergenic
1137764565 16:50967958-50967980 CTGGCCTATCCAACTTCAGAAGG + Intergenic
1138103833 16:54276155-54276177 CAGGCCTTTCTGACTCCAGAAGG - Intergenic
1140401580 16:74676212-74676234 CTGTGCTATCTGACTTTATGGGG + Intronic
1140837507 16:78808894-78808916 ATGGCCTAACGGAATTTAGATGG - Intronic
1140967915 16:79985069-79985091 CTGGCCTTTGTAAATTTAGATGG + Intergenic
1144790360 17:17855017-17855039 CTGGCCTACCTATCTTCAGAGGG - Intronic
1145307396 17:21682914-21682936 CTGGCGTATCTCACAGTAGATGG + Intergenic
1151204864 17:72499075-72499097 GTAGCCAACCTGACTTTAGATGG - Intergenic
1151941935 17:77298124-77298146 CTGGCATATGTGACTTTTGGAGG - Intronic
1157877209 18:51284860-51284882 CTGACCTGCCTGACGTTAGAAGG + Intergenic
1158666566 18:59438143-59438165 CTGGCCTTTCTGTTTTTAGGGGG - Exonic
1159389970 18:67778709-67778731 TTCCCCTTTCTGACTTTAGAGGG - Intergenic
1162444832 19:10716431-10716453 CTGGCCTATTTGTCTCCAGAGGG + Intergenic
925114705 2:1368774-1368796 CTTGTCTATCTGACATTAGGAGG + Intergenic
929123750 2:38504264-38504286 CTTGCCTATGTGACCTGAGAGGG - Intergenic
939091303 2:137782796-137782818 CTGACCTTTTTGACTTTTGAGGG + Intergenic
939749102 2:146018837-146018859 ATGGCCTATCTGACCTAAGTGGG + Intergenic
941138885 2:161752173-161752195 CTGACCTATCTCACTTGAGTAGG + Intronic
944809406 2:203312892-203312914 CGGACATGTCTGACTTTAGAGGG + Intergenic
945043631 2:205763329-205763351 CTGGCCTCTCAGAATCTAGAGGG + Intronic
946623257 2:221581568-221581590 ATGACCTATCTGACTTTTCAGGG - Intergenic
1172372381 20:34404835-34404857 CTGGCCTAACAAACTTTACATGG - Intronic
1176019921 20:62957319-62957341 CTGGCCTGTCTGCCTCTACAGGG - Intronic
1177888505 21:26776136-26776158 TTGTTCTATCTGATTTTAGATGG + Intergenic
1180579535 22:16818670-16818692 CTGCCTCCTCTGACTTTAGAGGG - Intronic
1181273389 22:21673813-21673835 CTGGCCCATGTGACTTTTGGGGG + Intronic
1181869940 22:25890238-25890260 ATGGCCTATCTGCCTCTAGCAGG - Intronic
949172673 3:1020359-1020381 TTGATCTTTCTGACTTTAGATGG + Intergenic
949238590 3:1841830-1841852 ATGGCCTTTCAGAGTTTAGAGGG - Intergenic
949288216 3:2431226-2431248 CTGGCCTATCTTATTTTTAATGG - Intronic
950654080 3:14425843-14425865 CTGGCCAGTCTGAATTTAAATGG + Intronic
953079984 3:39608136-39608158 GTGGCCTATCTGACTACAGGTGG + Intergenic
956072306 3:65466573-65466595 CTGGCCTCTCTGACTCCACAGGG + Intronic
956366897 3:68514039-68514061 CTGTCTTCTCTGACTTTACATGG + Intronic
956934525 3:74084846-74084868 CTGGGCTATTTGACTCTACAGGG + Intergenic
959367346 3:105478446-105478468 CTTGACTTTCTGACTTGAGAGGG - Intronic
970637791 4:18028502-18028524 CTAGACTATCAGAGTTTAGAGGG + Intergenic
974169986 4:58254223-58254245 CTGGCCTAAGTGACTTAAGATGG - Intergenic
974391997 4:61283135-61283157 CTGGCAGATCACACTTTAGAAGG + Intronic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
980702629 4:136452995-136453017 CTGGACTGTCTGACTGTTGAAGG + Intergenic
985005261 4:185528640-185528662 CTGTCCTAGCTGACTTCTGAAGG - Intronic
987067848 5:14307450-14307472 CAGGCCTTTCTTTCTTTAGATGG + Intronic
992668279 5:79033167-79033189 GTAGCATCTCTGACTTTAGATGG - Intronic
996327599 5:122293203-122293225 CTGGCCTATCTGAGCTCAGAAGG - Intergenic
1002921912 6:1579034-1579056 GTGGCCTCTCTGCCTTTGGAGGG - Intergenic
1004111073 6:12719712-12719734 CTGGCATCTTTCACTTTAGATGG + Intronic
1015440143 6:133239097-133239119 CTGAAAAATCTGACTTTAGAAGG + Intergenic
1016773909 6:147882690-147882712 ATGGCTTACCTGACATTAGAAGG - Intergenic
1025880953 7:65536082-65536104 CTGGCTTATTTCACTTTACATGG - Intergenic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1031621985 7:123945508-123945530 CTGACCTCTTTGGCTTTAGAGGG - Intronic
1038275692 8:26118968-26118990 CTGCCCTAGCTGCCCTTAGAAGG - Intergenic
1039725807 8:40215118-40215140 CTGCCCTTTCTGTCTATAGATGG + Intergenic
1046657511 8:116911587-116911609 CTGCCCTAGGTGACTTTATATGG - Intergenic
1048296776 8:133220510-133220532 CTGGCCCAGCTGCCTTTATAGGG - Intronic
1052548264 9:29909285-29909307 CTGGCCTATGTGAAATTAGTAGG + Intergenic
1057501173 9:95597605-95597627 CTGGCCTACCTGGCTGTAGGTGG + Intergenic
1059985846 9:119819633-119819655 CTCTCCTTTCTGACTTTGGAAGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061676722 9:132221448-132221470 CTGGTCTCTCTGACTTTTGCAGG - Intronic
1194958430 X:100208116-100208138 CTGGCCTATCTGCCTCCAGGTGG - Intergenic
1195135571 X:101904504-101904526 TTGCCATATCTGACATTAGAGGG - Intronic