ID: 1093471357

View in Genome Browser
Species Human (GRCh38)
Location 12:19505520-19505542
Sequence ATACCCCACTAATAATTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093471357_1093471358 -5 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471358 12:19505538-19505560 GGTATAAGCATTTTAGCTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1093471357_1093471363 24 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 135
1093471357_1093471360 5 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471360 12:19505548-19505570 TTTTAGCTAGAGGGAAGATGAGG 0: 1
1: 1
2: 0
3: 14
4: 300
1093471357_1093471359 -4 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471359 12:19505539-19505561 GTATAAGCATTTTAGCTAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 138
1093471357_1093471362 23 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471362 12:19505566-19505588 TGAGGTGTAACATCTTGAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 109
1093471357_1093471361 20 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471361 12:19505563-19505585 AGATGAGGTGTAACATCTTGAGG 0: 1
1: 0
2: 1
3: 21
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093471357 Original CRISPR ATACCCCACTAATAATTGAA TGG (reversed) Intronic