ID: 1093471363

View in Genome Browser
Species Human (GRCh38)
Location 12:19505567-19505589
Sequence GAGGTGTAACATCTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093471357_1093471363 24 Left 1093471357 12:19505520-19505542 CCATTCAATTATTAGTGGGGTAT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093471363 Original CRISPR GAGGTGTAACATCTTGAGGT GGG Intronic
900813222 1:4824102-4824124 AAGGTGGGACATCTTGAAGTGGG + Intergenic
901775228 1:11555969-11555991 GAAATGTAACATCTTGAGTTAGG + Intergenic
903612053 1:24622405-24622427 GAGGTGAAAGGTCCTGAGGTGGG - Intergenic
908416337 1:63916674-63916696 GAGGTCTCACATCAGGAGGTGGG - Intronic
908964068 1:69737013-69737035 GAGGTGTAAGAATTTGAGTTTGG - Intronic
909687438 1:78366319-78366341 GAGGTGGAACAGCTTTTGGTAGG - Intronic
912068632 1:105779508-105779530 GAGGTGAAACATCTGGATGCAGG - Intergenic
916028174 1:160853415-160853437 AATGTGTTACATCTTGATGTGGG + Intronic
918591118 1:186242453-186242475 CAGATGTACCATCTTCAGGTCGG + Intergenic
919242354 1:194931364-194931386 GAGTTGGAGCATCTGGAGGTTGG + Intergenic
920564729 1:206964284-206964306 GTGGTTCAACATCTTGCGGTAGG + Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921901603 1:220457052-220457074 AAGGTGGAACATCTTGAAGGAGG + Intergenic
922847880 1:228704171-228704193 AAGGCGGAACAACTTGAGGTGGG - Intergenic
923386610 1:233471449-233471471 GAGGTGGAATATCTTGAAGTGGG - Intergenic
924025476 1:239828598-239828620 GAGGTGCAAAAGCCTGAGGTGGG + Intronic
1062923468 10:1297359-1297381 GATGTGTAAAAACTTGAGTTTGG - Intronic
1066531846 10:36349560-36349582 AAGTTGTAATAACTTGAGGTCGG + Intergenic
1071858765 10:89651320-89651342 GAGGTGGAACATCTAGAAGCAGG + Intergenic
1075018161 10:118926417-118926439 CAGTTGTCACATCTTGGGGTGGG - Intergenic
1077958194 11:7044095-7044117 GAGTTGTCCCATCTTGAGGCAGG + Intronic
1085624736 11:78063422-78063444 GAAGTGAAACAGCTTGATGTGGG - Intronic
1085902380 11:80716722-80716744 GAGGTGAAACAAACTGAGGTAGG + Intergenic
1086268936 11:85036113-85036135 GAGGGATAACATTTTGAGATAGG - Intronic
1087042504 11:93815577-93815599 AAGGTGGGACATCTTGAAGTAGG - Intergenic
1087936320 11:104037644-104037666 GCGATGTAACATCATGAGGCTGG + Exonic
1090432211 11:126655520-126655542 GAAGAGAAACAACTTGAGGTGGG - Intronic
1092762376 12:11821482-11821504 GATGAGTGACATCTGGAGGTTGG + Intronic
1092952927 12:13524937-13524959 GAGGAGTAACATATTAAGATAGG + Intergenic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1093674031 12:21913562-21913584 GAGGAGAAACAACTTGAAGTTGG - Intronic
1096190279 12:49613223-49613245 GAGATCTAACTTTTTGAGGTAGG - Intronic
1100340326 12:93673175-93673197 GAGGTGTGACAACTTGAGGCAGG - Intergenic
1101418878 12:104532599-104532621 GATGTGTAAAAATTTGAGGTTGG - Intronic
1102019903 12:109675148-109675170 GATGGGTCACATCTTGAAGTAGG - Intergenic
1103149785 12:118627080-118627102 GAGGGGTGAGATCTTTAGGTGGG + Intergenic
1106090840 13:26591821-26591843 GAGTTGTAGGTTCTTGAGGTCGG + Intronic
1107655821 13:42591376-42591398 GAGGGGAAAAATCATGAGGTGGG - Intronic
1109252638 13:60038442-60038464 CAGGTGGAACATCTTGATTTCGG - Intronic
1111581054 13:90224429-90224451 GAAATGTAACATCTTAAGTTAGG + Intergenic
1115010006 14:28534700-28534722 GAGATCTAACTTCTTGATGTAGG + Intergenic
1115532919 14:34343510-34343532 GAGGTGGAATATCTTGAAGTGGG - Intronic
1117599662 14:57362321-57362343 AAGGTGGGACATCTTGAAGTAGG + Intergenic
1126455340 15:48855467-48855489 GAGGTGGAACATTATTAGGTTGG + Intronic
1127369577 15:58325864-58325886 GAGATCTAACTTTTTGAGGTAGG + Intronic
1128864569 15:71104715-71104737 AAGGTGTGATATCTTGAAGTGGG + Intronic
1130432112 15:83859207-83859229 AAGGTGGAATATCTTGAAGTGGG + Intronic
1131419500 15:92292880-92292902 GAGGTGTAACACCTAGGAGTTGG + Intergenic
1137927405 16:52553658-52553680 TGGGTGGAACATCTTGAGGTAGG + Intergenic
1139763795 16:69209842-69209864 TAGTTTAAACATCTTGAGGTGGG - Intronic
1140175619 16:72656650-72656672 GAGGTGTTAAATTTTGAGGTAGG + Intergenic
1141807031 16:86348614-86348636 GAGGTCTCACATGTTTAGGTGGG + Intergenic
1142809323 17:2387807-2387829 GAGGTGTAACATCTGAGGGCTGG + Intronic
1146022388 17:29291393-29291415 TATCTGTAACATGTTGAGGTAGG - Intronic
1146805903 17:35864845-35864867 GAGATGGAACATTTTGATGTGGG + Exonic
1150480764 17:65507570-65507592 GAGGTTTAAAATCTCTAGGTAGG - Intergenic
1151798747 17:76364791-76364813 AAGGTGGGACATCTTGAAGTGGG - Intronic
1153157026 18:2161519-2161541 TAGGTATAACATCCTGAGGAGGG - Intergenic
1153607948 18:6853814-6853836 AAGGTGGAACAACTTGAAGTAGG - Intronic
1158006299 18:52675438-52675460 AAGGTGGAACAACTTGAAGTTGG - Intronic
1158741439 18:60146728-60146750 GAGGTGTAGCATCTTTAGGCAGG - Intergenic
1161751348 19:6099537-6099559 AAGGTTTACCATCTTGATGTAGG + Intronic
1164194173 19:22939985-22940007 GAGGTGGCAGATCATGAGGTGGG + Intergenic
1168681652 19:58320218-58320240 GAGGTGTGACATCTGGATGCAGG - Intergenic
925785494 2:7428605-7428627 GAGGTGCAAGATCTTGAGGCTGG + Intergenic
925954733 2:8952029-8952051 GAGATCTAACTTTTTGAGGTGGG + Intronic
926924349 2:17971977-17971999 CAAGTGAAACATCTTGAGGAGGG - Intronic
927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG + Intergenic
928048239 2:27961068-27961090 TAGGAGTAACAACTTGTGGTTGG + Intronic
930843872 2:55880117-55880139 GGGGTGTAATATTTTGTGGTGGG + Intronic
931787164 2:65630601-65630623 GAGTTTTAAGATCTTAAGGTTGG + Intergenic
933830113 2:86199895-86199917 GAGGTGTAGAATCTTAAGTTAGG - Intronic
935978969 2:108608053-108608075 AAGGTGTTATTTCTTGAGGTGGG - Intronic
937780775 2:125834655-125834677 AAGGTGGGACATCTTGAGGCAGG + Intergenic
938690942 2:133788503-133788525 GGAATGTAACATCTTGAGTTAGG - Intergenic
940584462 2:155627851-155627873 GAGATGTAAAATGTTGAGATTGG + Intergenic
940861902 2:158779386-158779408 GAATTTGAACATCTTGAGGTGGG - Intergenic
942605096 2:177682242-177682264 AAGGCGGAACATCTTGAAGTGGG - Intronic
942819526 2:180095583-180095605 GAGATCTAACATTTTGATGTGGG - Intergenic
947573545 2:231254200-231254222 TGTGTGTATCATCTTGAGGTAGG + Intronic
948128867 2:235585436-235585458 GAGGTGAAAGATTTTGAGATGGG - Intronic
948161906 2:235831562-235831584 GAGGTGTAACCTTTTCAGATTGG + Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1175171730 20:57085689-57085711 GTGGGGTCTCATCTTGAGGTTGG - Intergenic
1176524731 21:7857551-7857573 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1177542900 21:22518935-22518957 AATGTGCATCATCTTGAGGTAGG + Intergenic
1178658751 21:34487564-34487586 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1182272094 22:29160762-29160784 GAGGTCTAACTTCTTGAGGTAGG - Intronic
949150066 3:756143-756165 GAGATCTAACATTTTGAAGTAGG - Intergenic
958491322 3:94777397-94777419 GGAATGTAACATCTTGAGTTAGG - Intergenic
963915142 3:150852349-150852371 GAAATGTAACATCTTGAGATAGG + Intergenic
964555724 3:157936083-157936105 GAGGTATAACATCATGTGGCGGG - Intergenic
965528701 3:169748945-169748967 AAGGTGTATCACATTGAGGTGGG + Intergenic
967314314 3:188136750-188136772 GAGGTGGAAAAGCGTGAGGTAGG + Intergenic
969346375 4:6573133-6573155 AAGGTGGGACATCTTGAAGTGGG - Intergenic
969661921 4:8535291-8535313 AAGGTGGGACATCTTGAAGTAGG - Intergenic
970014533 4:11498743-11498765 GATGTGTATCCTCTTGGGGTGGG + Intergenic
970061711 4:12040891-12040913 GAAGTGAAACATACTGAGGTGGG + Intergenic
971589365 4:28447399-28447421 GAACTGTAACATCTTGAGTTAGG - Intergenic
972177831 4:36428989-36429011 GAGATCTAACATTTTGATGTGGG - Intergenic
976108834 4:81648591-81648613 GAGTTGTATCATTTGGAGGTTGG + Intronic
981563892 4:146077602-146077624 GAGGTTTATCATCTTTATGTAGG - Intergenic
982873826 4:160619130-160619152 GTGGTGTAATTTCTTGAGCTCGG + Intergenic
983674910 4:170280974-170280996 GAGGAGTGTTATCTTGAGGTTGG - Intergenic
983698625 4:170564251-170564273 GAGGTGGAAGTTCTTGTGGTTGG + Intergenic
984575132 4:181438845-181438867 GAAATGCAACATCTTGAGATAGG - Intergenic
985311665 4:188607909-188607931 GAGGTGTGACTTCTAGAGATAGG + Intergenic
986872655 5:12068283-12068305 GAGCAGTAACATTTTGAGGGAGG + Intergenic
987530535 5:19113574-19113596 TGGATGTAACATCTTGAGTTAGG + Intergenic
987857255 5:23437035-23437057 GAGCTTTAACATCTAGAGGAAGG + Intergenic
988403460 5:30793304-30793326 AAAATGTAACATCTTGAGCTAGG - Intergenic
989401640 5:41014091-41014113 GAAGTGAAATATCTTGAGGACGG - Intronic
993492100 5:88564797-88564819 CATGTGTAATAACTTGAGGTAGG - Intergenic
994089354 5:95795644-95795666 GAGCTGTGACATCTGGATGTTGG - Exonic
994330409 5:98498476-98498498 GAGATGAAACATATTGAGGAAGG + Intergenic
996401644 5:123069348-123069370 TACGTGAAAGATCTTGAGGTGGG + Intergenic
996708213 5:126518581-126518603 GAGGTGGGACAACTTGAAGTGGG - Intergenic
998378181 5:141705194-141705216 CAAGTGTAAAATCCTGAGGTGGG - Intergenic
999289894 5:150417560-150417582 AAGGTGGGACATCTTGAAGTGGG - Intergenic
999439109 5:151587647-151587669 GTGGTTTAATATCTTGGGGTAGG - Intergenic
1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG + Intronic
1004773972 6:18821650-18821672 AATGTGTAGCATCTTGATGTAGG - Intergenic
1012815687 6:104019073-104019095 GAGGTGGAACAGTTAGAGGTGGG + Intergenic
1014848816 6:126314238-126314260 GAGGTGGGACAACTTGAAGTGGG - Intergenic
1017347749 6:153404696-153404718 GAAGTGGGACATCTTGAAGTAGG + Intergenic
1021268932 7:18560748-18560770 GAGGTGAAGCATTTTGATGTGGG + Intronic
1024383711 7:48727054-48727076 AAGGTGGAATATCTTGAAGTGGG - Intergenic
1024898767 7:54293167-54293189 AAGGTGGGACATCTTGAAGTGGG + Intergenic
1026138040 7:67680610-67680632 GAGGTGTTAGATCATGAGGTTGG - Intergenic
1032137822 7:129297463-129297485 GAAGTGTCACATGTTGAGATAGG + Intronic
1035556454 8:570680-570702 GAGGTGGGACATCTTGAAGGGGG - Intergenic
1038293971 8:26274062-26274084 GAGGTGGGACAACTTGAAGTAGG - Intergenic
1039573451 8:38604920-38604942 AAGGTGGGACATCTTGAAGTGGG - Intergenic
1040622859 8:49109027-49109049 GAGGTGAGACATCTTCAAGTGGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1044648309 8:94468139-94468161 AAGGTGAGACATCTTGAAGTGGG - Intronic
1049801756 8:144521003-144521025 CAGGTCCAACTTCTTGAGGTGGG - Exonic
1050187044 9:2985636-2985658 GAGTTGAACCACCTTGAGGTGGG - Intergenic
1050352030 9:4749377-4749399 GTTGTCTAACATTTTGAGGTTGG + Intergenic
1050646324 9:7723604-7723626 TTGGGGAAACATCTTGAGGTGGG + Intergenic
1055526133 9:77135669-77135691 GATGTGTAAAATTTTGAGTTCGG + Intergenic
1056361734 9:85864603-85864625 GAGATCTAACTTCTTGATGTAGG - Intergenic
1186878351 X:13839284-13839306 AAGGTGGGACATCTTGAAGTTGG - Intronic
1188151578 X:26682422-26682444 GAGTTGTATCAGTTTGAGGTAGG + Intergenic
1188905666 X:35788192-35788214 AAGGTGGGACAACTTGAGGTGGG - Intergenic
1193319553 X:80105646-80105668 AAGGTGGGACAACTTGAGGTTGG - Intergenic
1193538296 X:82739257-82739279 TAGGTGTAGCATCCTGAGGAGGG + Intergenic
1193850934 X:86536672-86536694 AAGGTGGGACATCTTGAAGTGGG - Intronic
1197075011 X:122343364-122343386 TGGATTTAACATCTTGAGGTCGG + Intergenic
1201594201 Y:15649425-15649447 GAGATGTAACATCCAGAGTTTGG + Intergenic