ID: 1093471363 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:19505567-19505589 |
Sequence | GAGGTGTAACATCTTGAGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 150 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093471357_1093471363 | 24 | Left | 1093471357 | 12:19505520-19505542 | CCATTCAATTATTAGTGGGGTAT | 0: 1 1: 0 2: 0 3: 8 4: 92 |
||
Right | 1093471363 | 12:19505567-19505589 | GAGGTGTAACATCTTGAGGTGGG | 0: 1 1: 0 2: 1 3: 13 4: 135 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093471363 | Original CRISPR | GAGGTGTAACATCTTGAGGT GGG | Intronic | ||