ID: 1093476997

View in Genome Browser
Species Human (GRCh38)
Location 12:19567101-19567123
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11554
Summary {0: 1, 1: 115, 2: 6888, 3: 3008, 4: 1542}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093476997 Original CRISPR ATCGTTCCTGCTTTCTGTTG TGG (reversed) Intronic
Too many off-targets to display for this crispr