ID: 1093482969

View in Genome Browser
Species Human (GRCh38)
Location 12:19624229-19624251
Sequence CTGGGTACTGACTGTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093482969_1093482974 13 Left 1093482969 12:19624229-19624251 CCTGCAGCACAGTCAGTACCCAG 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1093482974 12:19624265-19624287 ATATAATGAGATGGTAGAGATGG 0: 1
1: 0
2: 2
3: 32
4: 359
1093482969_1093482972 4 Left 1093482969 12:19624229-19624251 CCTGCAGCACAGTCAGTACCCAG 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1093482972 12:19624256-19624278 ACACCACTTATATAATGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 133
1093482969_1093482975 14 Left 1093482969 12:19624229-19624251 CCTGCAGCACAGTCAGTACCCAG 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1093482975 12:19624266-19624288 TATAATGAGATGGTAGAGATGGG 0: 1
1: 0
2: 3
3: 22
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093482969 Original CRISPR CTGGGTACTGACTGTGCTGC AGG (reversed) Intronic
902328994 1:15721352-15721374 CTGGGTACAGACGGCACTGCTGG - Exonic
908358526 1:63345476-63345498 TTGGGTACTTACTATGCTTCAGG - Intergenic
911131282 1:94390790-94390812 CTGGTTTCTGAATGTGCTGTCGG - Intergenic
915018836 1:152760977-152760999 CTGGGTGCTCACAGGGCTGCAGG - Exonic
915020792 1:152776788-152776810 CTTGGGACTGACTGTGTTGCTGG + Intronic
915451547 1:156008945-156008967 CTGGGTTCTGGCCTTGCTGCAGG - Intergenic
915530954 1:156501606-156501628 CTGGGTGTTTACTGTGCGGCGGG - Intergenic
917498827 1:175567320-175567342 CTGAGAGCTGACAGTGCTGCGGG + Intronic
917647373 1:177042341-177042363 CAGGCTAGGGACTGTGCTGCTGG - Intronic
919109760 1:193203825-193203847 CTTGGTACTGGCTGGGCTGCAGG - Exonic
919745378 1:201005389-201005411 CTGGGTGCTGGCTGTGGTGCGGG + Exonic
919811103 1:201409320-201409342 CTGGGGACTGCATGTGCTGTAGG - Intronic
920642300 1:207764196-207764218 CTGGGCACGGACTGAGCTCCTGG + Intronic
920650044 1:207830937-207830959 CTGGGGACAGCCTGTGCTGGAGG + Intergenic
920681096 1:208073361-208073383 CTGGAAACTGACTGCCCTGCAGG - Intronic
920727567 1:208450454-208450476 CTCGGCACTCCCTGTGCTGCTGG - Intergenic
922321952 1:224496303-224496325 CTGAGCACTTTCTGTGCTGCTGG + Intronic
1063203422 10:3807619-3807641 ATGTGGACTGACTGTCCTGCTGG + Intergenic
1063753697 10:8981820-8981842 CTGGGCACTTACTGTGGAGCAGG - Intergenic
1065341825 10:24714434-24714456 CTGGGTACTCACTTTGCTGATGG + Intronic
1065428768 10:25632392-25632414 CTGGATAAGGACTGTGCAGCTGG - Intergenic
1066488786 10:35874086-35874108 CAGGGTCCTGACTGAGTTGCAGG - Intergenic
1068949553 10:62763287-62763309 CTGAGAACAGACTGTGCGGCTGG + Intergenic
1069238814 10:66112250-66112272 CTGAGTACTGACTGTGTGCCAGG - Intronic
1069515097 10:69070948-69070970 CTGGGCACTGACTGTGTGGCTGG + Intergenic
1069706425 10:70461483-70461505 CTGGGTGCTGACTGTGTGCCTGG - Intergenic
1070457040 10:76627531-76627553 CTGGTTACTGTGTTTGCTGCAGG - Intergenic
1070552221 10:77498913-77498935 CTGGGTACTGACTGGGGGCCAGG - Intronic
1070712223 10:78691125-78691147 CTAGGTACCTACTGTGCTCCTGG + Intergenic
1070907076 10:80082345-80082367 CTGGGTACTGCCTCTGCTCCAGG - Intronic
1070986797 10:80696421-80696443 ATGGGTGCTGCCTCTGCTGCTGG + Intergenic
1073034816 10:100556399-100556421 TTGCCTTCTGACTGTGCTGCTGG - Exonic
1073754467 10:106566088-106566110 CTGGGTGCTGTATGAGCTGCTGG + Intergenic
1074981236 10:118621429-118621451 CTGGTGACTGACAGGGCTGCAGG - Intergenic
1076306733 10:129470627-129470649 CTGAGGACTGGCTTTGCTGCCGG - Intronic
1076666323 10:132095016-132095038 CTGGGTGAGGCCTGTGCTGCTGG - Intergenic
1077340940 11:2026038-2026060 CAGGGCACAGGCTGTGCTGCTGG - Intergenic
1077443367 11:2578909-2578931 CTGGGCAGTCACTGTGCTGAGGG - Intronic
1078264599 11:9745039-9745061 CTGGGTACTTACTGTGTGCCAGG - Intronic
1078398987 11:11007685-11007707 CTGGATTCTGAAGGTGCTGCAGG - Intergenic
1083302244 11:61745307-61745329 CAGGGCACTGACTCTGCAGCTGG - Exonic
1083540194 11:63506943-63506965 TTGGGCACTGACTGAGCTGGAGG - Intronic
1084345376 11:68543723-68543745 CTGGGTCCTGGCTGTCCAGCAGG + Intronic
1084961076 11:72717029-72717051 ATTGCTACTGACTGGGCTGCGGG - Intronic
1086862914 11:91946381-91946403 CTGGGTCTTGACTATGCTACAGG + Intergenic
1087327246 11:96738826-96738848 TTGGGCACTGGCTGTGCTGGGGG + Intergenic
1090385644 11:126356217-126356239 TTGGGAGCTGACTGTGCTGGAGG + Intronic
1091290371 11:134436114-134436136 CTGGGGAGTGACTGTGGTGAGGG - Intergenic
1202823925 11_KI270721v1_random:81227-81249 CAGGGCACAGGCTGTGCTGCTGG - Intergenic
1091667332 12:2428781-2428803 CTGGGCAGTGACTTTGCAGCGGG + Intronic
1091704774 12:2686305-2686327 CTGGGGACTGTCTGGCCTGCTGG - Intronic
1091711342 12:2742644-2742666 CTGGGGACTGTCTGGCCTGCTGG - Intergenic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1094158120 12:27359390-27359412 CTCGGTACTTACTGTGGGGCTGG + Intronic
1095570580 12:43680238-43680260 CTGGTTACTCACTGTGTTCCAGG - Intergenic
1096579220 12:52573665-52573687 CTGGCTTCTTACTGTGCAGCTGG - Exonic
1098233028 12:68392067-68392089 CTTATTACTGACAGTGCTGCAGG + Intergenic
1104682569 12:130761647-130761669 CTGGGTGCTGCTTGTGGTGCAGG - Intergenic
1110024863 13:70523802-70523824 CTGGATATTGTTTGTGCTGCTGG + Intergenic
1110039765 13:70738444-70738466 CTTGTCCCTGACTGTGCTGCTGG + Intergenic
1112796835 13:103066297-103066319 CTGGGCCCTGGCTCTGCTGCTGG + Exonic
1113412541 13:110102860-110102882 TTGGGTCCCGACTGTGTTGCAGG - Intergenic
1113521790 13:110946773-110946795 CTGGGACTTGACTGTTCTGCAGG - Intergenic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1113709372 13:112453680-112453702 CTGTGTCCTGATTGTGGTGCAGG - Intergenic
1117065574 14:52010496-52010518 CTGGTTTCTAAATGTGCTGCTGG + Exonic
1121300057 14:92862915-92862937 CTGGGCTCTGACTGTCCTGGGGG + Intergenic
1121603957 14:95226970-95226992 CTGGGTGCTGTCTCTGCTCCTGG + Intronic
1122857222 14:104565728-104565750 CTGAGCACTGACTGCCCTGCTGG - Intronic
1123671859 15:22666697-22666719 CTGGTTATTGCTTGTGCTGCAGG - Intergenic
1123925534 15:25106390-25106412 CTGGTCACTGGCTGTGATGCTGG + Intergenic
1124323903 15:28739909-28739931 CTGGTTATTGCTTGTGCTGCAGG - Intergenic
1124527786 15:30473161-30473183 CTGGTTATTGCTTGTGCTGCAGG - Intergenic
1124719796 15:32101654-32101676 CTGGGGACTGGCTGTGGTGCAGG - Intronic
1124770872 15:32534541-32534563 CTGGTTATTGCTTGTGCTGCAGG + Intergenic
1125956985 15:43797307-43797329 CTGGTTCCTGGCTGTCCTGCTGG - Exonic
1127872253 15:63083330-63083352 CTGGGTGATGCCGGTGCTGCTGG + Intergenic
1128626044 15:69205086-69205108 CTGGATATTGACTGTGATGGTGG - Intronic
1129824158 15:78623742-78623764 CTGGGTCCTGATTGTGATGGTGG + Intergenic
1130063755 15:80588216-80588238 TTGATTACTGACTGTGCTGAGGG - Intronic
1130317910 15:82812069-82812091 CTGGTTACTGCTTCTGCTGCAGG - Intronic
1130776936 15:86994123-86994145 CTGGTTACTTTCTTTGCTGCGGG - Intronic
1132397755 15:101487376-101487398 CTGGGTACGGAGTGTGCATCGGG + Intronic
1132572475 16:649953-649975 CTGGGTGCTGTCGGTGATGCGGG + Intronic
1133267073 16:4591753-4591775 CTGGATCCTGACAGTGCTGCTGG + Exonic
1134098045 16:11432165-11432187 CTGGGAACTGACTCAGCTGAAGG + Intronic
1134179985 16:12039808-12039830 CTGTTTACTAACTGTGTTGCTGG + Intronic
1135306732 16:21373575-21373597 CTGTTTACTAACTGTGTTGCTGG + Intergenic
1137521863 16:49201681-49201703 CTGGTTAGTGACTGCGCTCCTGG + Intergenic
1137943714 16:52714125-52714147 CTGGATCCTGGCTCTGCTGCTGG - Intergenic
1139362219 16:66406884-66406906 CTTGGTGCTGGCTGGGCTGCTGG - Intergenic
1139964140 16:70736263-70736285 CTGAGTGCAGACTGTGCGGCAGG - Intronic
1140292812 16:73678709-73678731 CTGTGTAATCACTGTGGTGCTGG - Intergenic
1140475046 16:75235582-75235604 CTGGCTGCTGCGTGTGCTGCCGG + Exonic
1141257992 16:82421469-82421491 CTGGGTCCTGACTCTACTCCTGG - Intergenic
1141853147 16:86661467-86661489 CTGGGGACTGACAGTCCAGCTGG - Intergenic
1142588250 17:987787-987809 CTGGGCACTAACTGTGGTGTCGG + Intergenic
1143189969 17:5033876-5033898 CTGGGCACTGACTGCCCTTCTGG - Exonic
1143645563 17:8227901-8227923 CTGGGTTCTGACTTTGTCGCAGG - Exonic
1144211688 17:13021174-13021196 CTGGGTACTGGCCCTGCTGGGGG + Intergenic
1144939353 17:18926847-18926869 CTGTGTCCTGACTGTGGTGGTGG - Intronic
1147929695 17:43970665-43970687 CTGTGTCCTGACTATGCTGGCGG - Intronic
1150637125 17:66921200-66921222 CTGGCTGCTGGCTGTGATGCTGG - Intergenic
1151543341 17:74776556-74776578 TTGGGAGCTGGCTGTGCTGCAGG + Exonic
1152206180 17:78975907-78975929 CTGGGAGCTGGCTGTGCTGTGGG + Intronic
1152315724 17:79579284-79579306 CCGGGTGCTGGCTCTGCTGCCGG + Intergenic
1152562584 17:81085984-81086006 CTGGTGCCTGACTCTGCTGCCGG + Intronic
1152731468 17:81973617-81973639 CTGGGTGCTGAGTGTGCTCATGG - Intergenic
1154355633 18:13621657-13621679 CTGGGTCCTGGAGGTGCTGCGGG + Intronic
1155496513 18:26447921-26447943 CTGGACACTGACAGGGCTGCAGG - Intergenic
1160415486 18:78706930-78706952 CTGTGCACTGACTGTGCTGGTGG - Intergenic
1161480672 19:4508809-4508831 CTTGGAACTGGCCGTGCTGCAGG + Exonic
1162420076 19:10561139-10561161 CTGGGGCCTGACTGGACTGCTGG - Intronic
1163399908 19:17085954-17085976 CTGGGTGGTGGCTGGGCTGCAGG - Intronic
1163529430 19:17841248-17841270 CTGAGCGCTGACTGTGCGGCAGG + Intronic
1164424040 19:28124412-28124434 CTGAGTGCTGACCATGCTGCTGG + Intergenic
1164508565 19:28879029-28879051 CAGGCTCCTGCCTGTGCTGCTGG - Intergenic
1164662444 19:29988398-29988420 CCGTGTCCTGACTGTGGTGCTGG - Intronic
1165487926 19:36106615-36106637 CTGTGCACTGGCTGTGCTGTCGG - Intergenic
1165581176 19:36865111-36865133 CGGGAAACTGAATGTGCTGCAGG + Intronic
1165924605 19:39319752-39319774 CAGGATGCTGAATGTGCTGCAGG - Intergenic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1166523718 19:43498014-43498036 CTTGGTGCTGACTGTGAGGCAGG - Intronic
1166651969 19:44581575-44581597 CAGGGTCCTGACTGTGGTGAAGG - Intergenic
1167302216 19:48684706-48684728 CTGGATACTGTCTGAGGTGCTGG - Intergenic
925025364 2:602783-602805 CTGGGTCCTGGGTGAGCTGCGGG - Intergenic
925050004 2:806044-806066 CTGGGAACTGGCTGTGCTGGTGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
926943160 2:18159465-18159487 CTGGTTACTGTCAGTACTGCGGG + Intronic
929463458 2:42123417-42123439 CTGGGTACAGACAGTGCGGTAGG - Intergenic
929464623 2:42133473-42133495 CTGGGCTCTGAACGTGCTGCTGG + Intergenic
930993235 2:57685504-57685526 TTGGGCACTGGCTGTGCTGGAGG - Intergenic
931415086 2:62073098-62073120 CTGTTTCCTGTCTGTGCTGCTGG - Intronic
931896901 2:66742514-66742536 CTAGATACTGGCTGTGCTACTGG + Intergenic
932113818 2:69026479-69026501 CTGAGTACTGACTAAGCAGCAGG - Intronic
932750189 2:74366560-74366582 GTGGGTCGTGGCTGTGCTGCAGG - Exonic
932844430 2:75120674-75120696 CTGGGTCCTGGCTCTCCTGCTGG - Exonic
933720932 2:85397241-85397263 ATGGGTTATGTCTGTGCTGCTGG - Intronic
934503033 2:94873893-94873915 CTGGGGACCCTCTGTGCTGCAGG - Intronic
934612882 2:95753825-95753847 CTGGGTACAGCCTGTGTTGTAGG + Intergenic
934841399 2:97626420-97626442 CTGGGTACAGCCTGTGTTGTAGG - Intergenic
934987324 2:98897039-98897061 CTGCATCCTGACTGTGCTGGTGG - Intronic
938610724 2:132945101-132945123 CTGGGGAAAGGCTGTGCTGCTGG + Intronic
940591461 2:155733588-155733610 CTGGCTACTGTCTGTGCTAATGG + Intergenic
943101377 2:183491122-183491144 CTGTGAACTGGCTGTGCTCCAGG + Intergenic
944151338 2:196561758-196561780 CTGGATGTTGCCTGTGCTGCTGG - Intronic
946336214 2:219038375-219038397 CTGGGCGCTGATGGTGCTGCAGG + Exonic
947390261 2:229631725-229631747 CTGGTGACTGGCTGTGCAGCAGG - Intronic
947690500 2:232131803-232131825 TTGAGTACTAACTGTGCTCCAGG + Intronic
948642827 2:239386207-239386229 CCCAGTCCTGACTGTGCTGCTGG + Intronic
948896698 2:240931023-240931045 CAGGGTGCTGGCCGTGCTGCTGG - Exonic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170978277 20:21187329-21187351 CTGGGTTCTGACTTTGCTCGGGG - Intronic
1171305809 20:24104904-24104926 CTGGGTATAGAGTGTGCTGCTGG + Intergenic
1172121580 20:32602018-32602040 CTGGGGACTGACTGGCCTGCAGG + Intronic
1173551157 20:43933989-43934011 CTGGGAGCTGCGTGTGCTGCAGG + Intronic
1173744797 20:45428026-45428048 CTAGGTACTGACAGGGCTGCGGG - Intergenic
1173891783 20:46518168-46518190 ATGGGTTCTGTCTGTGCTTCAGG + Intergenic
1175418896 20:58819019-58819041 CTGGGAACTGGCTGCTCTGCAGG - Intergenic
1175814109 20:61874669-61874691 CTGGGGACTCAAGGTGCTGCTGG - Intronic
1176037951 20:63049458-63049480 CTGGGTCCTGCCTGTGTCGCTGG - Intergenic
1176372071 21:6068292-6068314 CTTGTTAGTGCCTGTGCTGCCGG + Intergenic
1176383944 21:6127722-6127744 CCGGGTCCTGCCTGTGCAGCTGG + Intergenic
1177942276 21:27425461-27425483 CTGGGTAATTAGTGAGCTGCTGG - Intergenic
1179474308 21:41633479-41633501 CTGGGTCCTGTGTGGGCTGCTGG + Intergenic
1179739530 21:43410516-43410538 CCGGGTCCTGCCTGTGCAGCTGG - Intergenic
1179751448 21:43470247-43470269 CTTGTTAGTGCCTGTGCTGCCGG - Intergenic
1182621518 22:31621169-31621191 CTGGGTGCTCACTGTGTTGGTGG - Intronic
1184744456 22:46448162-46448184 CTGGGTGCTGGGTGTGCTCCTGG + Intronic
1185232604 22:49691983-49692005 CTGGGTGCTGGCTGTGCTCGAGG - Intergenic
1185330403 22:50249704-50249726 CTGGGTACAGACAGCGCTGGTGG + Intronic
950554289 3:13685942-13685964 CTGGGCACTGAGAGAGCTGCTGG + Intergenic
950656406 3:14439722-14439744 CTGAGTACTCACTGCGCAGCGGG + Intronic
951624098 3:24641408-24641430 CTGGGTAGTGACTTTGCAACTGG + Intergenic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
953099449 3:39810247-39810269 CCGCGTACCTACTGTGCTGCGGG + Intronic
953661252 3:44893491-44893513 ATGGGGACTGTCTGTGCTGGGGG - Intronic
953884872 3:46709509-46709531 CTGGGGTCTGACTGTCCTGAGGG - Intronic
954193976 3:48985186-48985208 CTGGGCATTGTCTGGGCTGCAGG + Exonic
954557527 3:51530057-51530079 GTGGCTACTGACTGAGCTGTTGG + Intergenic
954794584 3:53155040-53155062 CTGGGAACTGGCTGTGTTTCCGG + Intergenic
955554125 3:60117866-60117888 CTGGGTACTGACCCTGCAGTTGG - Intronic
957466639 3:80602199-80602221 CTGTATCCTGACTGTGCTACTGG + Intergenic
959179308 3:102958229-102958251 CTGAGTCCTGACTGTCCTGAAGG - Intergenic
961111265 3:124285350-124285372 GTGGCTACTGACTGTCCTGTTGG - Intronic
961380111 3:126491541-126491563 CTGGCTACTGCCTTTGCTGCCGG + Intronic
961520890 3:127466837-127466859 CTGGTTACTGGCTGTGCCCCTGG - Intergenic
961722563 3:128906502-128906524 CTGTGTTCTGATTGTGCAGCAGG + Intronic
962468678 3:135685890-135685912 CTGGGCACTTTCTGTGGTGCTGG + Intergenic
962961874 3:140318666-140318688 CTAGGTACTTACCGTGATGCAGG + Intronic
963367407 3:144353995-144354017 CTGGCGACTGTCTGTGCTTCAGG + Intergenic
963732352 3:148986304-148986326 CTGGGTTCTGCATCTGCTGCAGG + Intergenic
966327018 3:178768140-178768162 CTAGGTACTTGCTGTGCTCCTGG + Intronic
967809225 3:193742662-193742684 CTGGGTTTTGACTGTTCAGCTGG + Intergenic
967847585 3:194056517-194056539 GTGGGTACTGAGTGGGCGGCGGG + Intergenic
968451817 4:679495-679517 CTGGGAACAGAATGTGCCGCAGG - Intronic
968598881 4:1499794-1499816 ATGGGTGCTGACTGTGGAGCAGG - Intergenic
969489044 4:7488449-7488471 CTGGCTACTGCATGTGGTGCAGG + Intronic
969631558 4:8341660-8341682 CTGGGAAGTGACTGTGCTCCTGG + Intergenic
971276759 4:25205711-25205733 CTGGGTTCTGACTGAGCCCCAGG + Intronic
972627582 4:40816177-40816199 CTGGTTACTGAATCTGCTGGCGG + Exonic
972931121 4:44072353-44072375 CTCGGTCCTGACTTTGCTCCAGG + Intergenic
978371791 4:108036516-108036538 GTGGGTCCTGGCAGTGCTGCTGG + Intergenic
978857646 4:113411559-113411581 CTGGGAACTGGCTGGGCTGCCGG + Intergenic
980564320 4:134518804-134518826 CTGGAAACTGACTAAGCTGCAGG + Intergenic
981919949 4:150076837-150076859 CTGGGTAATGCCAATGCTGCTGG - Intergenic
985382940 4:189414315-189414337 CTGGGTTCTGGCTGCCCTGCAGG + Intergenic
986122410 5:4853753-4853775 TTGGGAACTGACTGAGCAGCAGG - Intergenic
986771476 5:10978019-10978041 CTGGGTAGTGACTGAGCTTATGG - Intronic
988832687 5:35003110-35003132 CAGGGTCCTGACTGTGGAGCTGG + Intronic
989029538 5:37104295-37104317 CTGGGTTCTAACTATGCTCCAGG + Intergenic
990136334 5:52648827-52648849 CTGGGTACTGTCGTTGCTGTGGG - Intergenic
990998639 5:61759229-61759251 CTGGGTCCTGATTGTGCTGGCGG - Intergenic
992151163 5:73904882-73904904 CTCTGTGCTGACTGTGCTGAGGG + Intronic
997371485 5:133364018-133364040 CTGGGCCCTGAATGTGCTGCTGG + Intronic
997897667 5:137734386-137734408 CCTGGGACTGACTGTGCTGCTGG - Intronic
998557015 5:143135327-143135349 CTGAGCACTGACTCTGCTCCTGG - Intronic
999411178 5:151351105-151351127 CTGGGCACTGACTGTGACTCAGG - Intergenic
1004395594 6:15244920-15244942 CTGTGTACAGAGCGTGCTGCGGG - Intergenic
1005939164 6:30547830-30547852 CTGGGTACTTACTGTACTGCAGG - Intronic
1007202999 6:40126493-40126515 CTGAGTCCTCACAGTGCTGCTGG - Intergenic
1007227340 6:40324493-40324515 CTGTCTGCTGCCTGTGCTGCTGG + Intergenic
1007621190 6:43215779-43215801 CTCTGTGCTGCCTGTGCTGCTGG + Intronic
1007760104 6:44128251-44128273 CTGGGGACTGACTGGTCGGCGGG + Intronic
1007942587 6:45796290-45796312 CTGAATACTGAATGTGCAGCTGG - Intergenic
1010351160 6:74876197-74876219 CTGAGTACTTACTATGCTCCAGG + Intergenic
1013950874 6:115780478-115780500 CTGGCTACTGTATGTACTGCAGG - Intergenic
1016031057 6:139338678-139338700 CTGGCCACAGACTGTGCTTCTGG - Intergenic
1022538707 7:31115179-31115201 CTTGGAACTGTCTGTGGTGCTGG - Intergenic
1023057372 7:36300862-36300884 CTGGGTTCAGGCTGTGCTTCTGG + Exonic
1024582311 7:50809956-50809978 CTGGGTCCTGTCCGTGCTCCAGG + Intergenic
1028595028 7:92539070-92539092 CTAGGTGCTGCCAGTGCTGCTGG + Intergenic
1028601561 7:92606302-92606324 CTGGGCACAGACTGTGCTCATGG - Exonic
1029962309 7:104700911-104700933 CTGGTTACTGAATATGCAGCAGG - Intronic
1030050383 7:105532229-105532251 CTGGGTAGTGAGTGTGTCGCTGG + Exonic
1032016099 7:128381194-128381216 CTGGGTATTGGGTGGGCTGCTGG + Intergenic
1035385605 7:158470596-158470618 TTGGGAACTGACTGAGCAGCCGG - Intronic
1035733011 8:1865777-1865799 CTGGGTGCTCACTCTGCTTCCGG + Intronic
1036075517 8:5494694-5494716 CTGGCTCCTGATTGGGCTGCTGG - Intergenic
1036448291 8:8842620-8842642 CTGGGTGATGCCGGTGCTGCTGG - Intronic
1037164428 8:15810028-15810050 TTGGATAATGTCTGTGCTGCTGG + Intergenic
1040637777 8:49295736-49295758 CTGGGTGCTGCTGGTGCTGCTGG - Intergenic
1041380915 8:57253742-57253764 CTGGGTGCTGCGGGTGCTGCTGG + Intergenic
1041971454 8:63747518-63747540 CTGGGTCCTGACTGAGCTGAGGG - Intergenic
1044186128 8:89254069-89254091 CTGGGGTATGACTGTTCTGCAGG - Intergenic
1045826702 8:106406179-106406201 ATGAGTACAGACTGTGCTCCAGG - Intronic
1045870852 8:106925250-106925272 CTGGATGCTCACAGTGCTGCTGG + Intergenic
1046420755 8:113980328-113980350 CTGGGGAATGCCTGTCCTGCAGG + Intergenic
1047763241 8:127969631-127969653 CTGAGTACTCACTGTGTTCCAGG + Intergenic
1047772886 8:128044594-128044616 CTGAGTCCTTACTGTGTTGCAGG - Intergenic
1049047074 8:140161190-140161212 CTGGGTGCTTACTGTGTTCCAGG + Intronic
1049569865 8:143364345-143364367 CTGGGTGCTGAGTGTGCTTAGGG - Intergenic
1049767132 8:144360083-144360105 CTGGGCACTGACTGCCCTTCTGG + Exonic
1051276637 9:15405191-15405213 CTGGGCACTGTCTGTGGTCCTGG + Intergenic
1054828713 9:69599662-69599684 CTGGGTACTGCTGGTGCTACTGG - Intronic
1055472554 9:76627594-76627616 CAGGATACTGACTGGGCTTCCGG - Intronic
1056983620 9:91340834-91340856 CTGGGTGCAGACTGGCCTGCAGG - Intronic
1057227669 9:93301071-93301093 CTGGGCACTAACTGTGTTCCAGG - Intronic
1058893175 9:109378762-109378784 CTGGGTGCTGAGTGTGCAGTAGG + Exonic
1058941330 9:109815477-109815499 CTGGTGACTCACTGTGCTGAGGG + Intronic
1059474002 9:114529245-114529267 CAGGGTAGTGGCTGTGCTGAAGG + Intergenic
1061608218 9:131727675-131727697 CTAGGGACTGCCTGTGCTGCAGG - Intronic
1190047387 X:47123628-47123650 ATGGGGACTGGCTTTGCTGCAGG - Intergenic
1190627217 X:52347640-52347662 CTGGATACTGACTGTGATGGTGG - Intergenic
1190700816 X:52988493-52988515 CTGGATACTGACTGTGATGGTGG + Intronic
1195122040 X:101764606-101764628 CTCTGTACAGACTGTCCTGCAGG - Intergenic
1197179578 X:123519975-123519997 CTTGCTGCTGACAGTGCTGCTGG - Intergenic
1197785075 X:130190779-130190801 CTGGGTAGTGAATGTCCTGCTGG - Intergenic
1197902833 X:131392487-131392509 CTGGGTAGTGACTGACCTGCTGG - Intronic
1197902837 X:131392506-131392528 CTGGGTAGTGACTGGCCTCCTGG - Intronic
1200210638 X:154345348-154345370 CTGGGTCCTGCCTGGGCTGCTGG - Intergenic
1200220214 X:154386744-154386766 CTGGGTCCTGCCTGGGCTGCTGG + Intergenic
1201635757 Y:16120895-16120917 ATGGTTACTGACTGTGATACTGG - Intergenic