ID: 1093485521

View in Genome Browser
Species Human (GRCh38)
Location 12:19647930-19647952
Sequence GATTGAGTATGATCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093485517_1093485521 -10 Left 1093485517 12:19647917-19647939 CCCCAAATGGTGCGATTGAGTAT 0: 1
1: 0
2: 1
3: 3
4: 60
Right 1093485521 12:19647930-19647952 GATTGAGTATGATCACCTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 76
1093485515_1093485521 21 Left 1093485515 12:19647886-19647908 CCTTCACAGCTTGATGTTCTGTT 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1093485521 12:19647930-19647952 GATTGAGTATGATCACCTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093485521 Original CRISPR GATTGAGTATGATCACCTCA GGG Intronic
902098683 1:13967355-13967377 GATTGAGAAGGATTACCTCAGGG + Intergenic
902539272 1:17141217-17141239 CATTGAGCATGATGTCCTCAAGG - Intergenic
907971605 1:59388222-59388244 GCTTGGGTATGATTACCACATGG + Intronic
913130685 1:115835953-115835975 GATTGAGAGTCATCACATCAGGG + Intergenic
917711604 1:177690645-177690667 GTTTTGGTAGGATCACCTCAGGG - Intergenic
924402264 1:243697828-243697850 TGTAGAGTATTATCACCTCAAGG - Intronic
1066706654 10:38187190-38187212 CATTGTGCATGAGCACCTCATGG + Intergenic
1067243314 10:44515303-44515325 GATTGAGAAATATCACTTCATGG - Intergenic
1067371953 10:45692579-45692601 CATTGTGCATGAGCACCTCATGG + Intergenic
1067418296 10:46123690-46123712 CATTGTGCATGAGCACCTCATGG + Intergenic
1067446445 10:46351038-46351060 CATTGTGCATGAGCACCTCATGG + Intergenic
1067875437 10:50002516-50002538 CATTGTGCATGAGCACCTCATGG + Intronic
1067992129 10:51226313-51226335 GATTCACTATGATCAAGTCATGG + Intronic
1068833958 10:61531550-61531572 CATAGAGTATTATCACATCAGGG - Intergenic
1070119690 10:73563955-73563977 GAGAGAGTATCATGACCTCAGGG - Intronic
1070460743 10:76667193-76667215 GATTGAATATGGTCCCCTCCTGG - Intergenic
1071607080 10:87002156-87002178 CATTGTGCATGAGCACCTCATGG + Intergenic
1071670677 10:87606612-87606634 TATTGCCTATGATCACATCATGG - Intergenic
1078019697 11:7645636-7645658 GATTCTGTGTGAACACCTCAAGG + Intronic
1079094198 11:17500630-17500652 CATTGACTATGCTCAGCTCAGGG + Intronic
1083692767 11:64420430-64420452 GATGGAGTCTGATCAGCCCAGGG - Intergenic
1084990673 11:72921917-72921939 AAATGTGTATGATCATCTCAAGG - Exonic
1087840645 11:102917577-102917599 TATTTAGCATGATCTCCTCAAGG - Intergenic
1093485521 12:19647930-19647952 GATTGAGTATGATCACCTCAGGG + Intronic
1096130599 12:49155915-49155937 GATTGAGTTTGATCACCAAAAGG + Intergenic
1097130587 12:56808217-56808239 GATTGAATCAGCTCACCTCATGG - Intergenic
1101810224 12:108101605-108101627 GATTGAATCACATCACCTCAGGG + Intergenic
1101898218 12:108771320-108771342 TATTTAGTATGAGCACCCCATGG - Intergenic
1113412432 13:110102029-110102051 AAGTGAGTGTGACCACCTCATGG + Intergenic
1117523632 14:56575723-56575745 GATTAACTATGATAATCTCACGG - Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1119942413 14:78655693-78655715 AAATGAATATGATAACCTCATGG + Intronic
1125328120 15:38557509-38557531 GTTTGAGTAAGTGCACCTCATGG - Intronic
1139377911 16:66512042-66512064 GATTGAGGCTGACCACCACATGG - Exonic
1139430237 16:66907233-66907255 GATTGACCATCATCAGCTCATGG + Intergenic
1153459047 18:5313530-5313552 GATGGAATATGATCATATCAAGG - Intergenic
1153994833 18:10431864-10431886 GATTAACTATGAGCACGTCAAGG + Intergenic
1156007224 18:32456818-32456840 GAATGAGTATTTTCACATCACGG + Intronic
1161402221 19:4071855-4071877 CACTGAGTATGATGTCCTCAAGG - Intergenic
1168668976 19:58227163-58227185 CATTGCCTATGCTCACCTCAGGG - Intergenic
925229611 2:2221310-2221332 GATTGAGTCTGTGCACCTCTTGG + Intronic
927382905 2:22499535-22499557 CATTGAGTAAGATGACCTCCAGG - Intergenic
944815930 2:203375034-203375056 GAGTCAGTATGATTATCTCAAGG + Intronic
948527584 2:238581049-238581071 GAATGAGTATGAATTCCTCAGGG - Intergenic
1169915826 20:10682051-10682073 GATTGAGGATGATCACAACCTGG + Intergenic
1171880732 20:30616114-30616136 GATTTAGTAAAACCACCTCAGGG + Intergenic
1183610303 22:38898282-38898304 GATTTTGTATGATAACATCAGGG + Intergenic
1184938416 22:47741694-47741716 GAAGGAGTTTGACCACCTCAGGG - Intergenic
949974204 3:9439912-9439934 GATTGATTAAGATCACATCTAGG + Intronic
952562796 3:34614984-34615006 AATTGAGTATGATTTACTCAAGG + Intergenic
955304031 3:57811367-57811389 GATTCAGTATAATGTCCTCAAGG + Intronic
957514518 3:81233330-81233352 GATTCCGTATGATCAACTGATGG - Intergenic
957628470 3:82686262-82686284 GATTGAGTCTGATTTCTTCAAGG + Intergenic
967193412 3:187005192-187005214 GTTTCAGTATTATCAACTCATGG - Intronic
967216692 3:187216864-187216886 CATTGAGTAAGATTAACTCAAGG + Intergenic
974229169 4:59087748-59087770 GATTGATTATTATCACCTGATGG + Intergenic
976361941 4:84190095-84190117 GAATGAGGATGATCAAGTCAAGG + Intergenic
986843169 5:11721742-11721764 TCTTGAGCATGTTCACCTCATGG + Intronic
987075333 5:14376808-14376830 AACTGAGTATGATGACCCCAGGG - Intronic
992392150 5:76339060-76339082 GTTTGAGCAGGGTCACCTCAAGG + Intronic
995781290 5:115778164-115778186 TATAGACTATGAACACCTCAGGG + Intergenic
996651492 5:125882352-125882374 GATTGAGTAGGATCAGTTCATGG + Intergenic
1003733883 6:8855796-8855818 TATTGATTTTGGTCACCTCATGG + Intergenic
1004436574 6:15600926-15600948 GTTTGATAATGATCACCTTATGG + Intronic
1005227254 6:23657026-23657048 GAATTAGAATGATCACATCAAGG - Intergenic
1005680083 6:28197957-28197979 GTTTGAGGAAGACCACCTCAGGG + Intergenic
1010266737 6:73876227-73876249 GCTTGAGTGTGTTCATCTCATGG + Intergenic
1015731114 6:136349223-136349245 GAGTAAGAATGATCAGCTCAAGG + Intronic
1016981252 6:149856696-149856718 GATTGAGAATGAGCAAATCAAGG + Intronic
1027738128 7:81961997-81962019 GATGGAGGATGATGACTTCACGG - Exonic
1028215619 7:88128655-88128677 GATTGTGAATGATCACCTTATGG + Exonic
1029404206 7:100364477-100364499 GGTGAAGTATGATCACATCAAGG + Intronic
1033040409 7:137912388-137912410 AAAAAAGTATGATCACCTCAAGG + Intronic
1036740893 8:11360854-11360876 AATTAAGTATGATAAACTCATGG + Intergenic
1037746039 8:21645410-21645432 CATTGGGAATGATCATCTCATGG - Intergenic
1044319217 8:90783733-90783755 GATTGAATCTACTCACCTCAAGG + Intronic
1046041051 8:108905395-108905417 GTTTGAGTATGATAACCTCCAGG - Intergenic
1047884176 8:129230176-129230198 GATTGAGTATTAAAACATCAGGG + Intergenic
1048169342 8:132090611-132090633 GATATAGTAAGACCACCTCATGG - Intronic
1052282760 9:26752113-26752135 CATTGAGCATGATGTCCTCAAGG - Intergenic
1053259711 9:36651745-36651767 GTGGCAGTATGATCACCTCACGG + Exonic
1056378875 9:86039649-86039671 GACTGAGTATGAATACCTCAGGG - Intronic
1059522391 9:114955825-114955847 GATTGAAAATGATCACGCCAGGG - Intergenic
1198316141 X:135468491-135468513 GATTGAGGTTGACCACTTCAAGG + Intergenic