ID: 1093489515

View in Genome Browser
Species Human (GRCh38)
Location 12:19688831-19688853
Sequence CAGTGAGGGAGTTCACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093489515 Original CRISPR CAGTGAGGGAGTTCACCATA TGG (reversed) Intronic
902655973 1:17868671-17868693 AGGTGAGGGAGTTGACAATATGG + Intergenic
905370883 1:37482197-37482219 CAGAGAGGGAGTTCCCCTAAAGG + Intronic
905444855 1:38020454-38020476 CAGTGACGGAAAGCACCATAAGG - Intronic
905702240 1:40026266-40026288 CAGTGAAGGAGTCCCACATAAGG + Intergenic
906398579 1:45488363-45488385 AAGTGAGGGAGTTTAACAGATGG - Intronic
909945260 1:81656305-81656327 CAGTGAGGTAGGTCTCCATTTGG - Intronic
910444284 1:87284644-87284666 CAGTGAGGCAGTTTTCCCTAGGG + Intergenic
910530124 1:88226437-88226459 CTGTGTGGCAGTTCACCCTAAGG + Intergenic
915104736 1:153526751-153526773 AGGTGAGAGAGTTCCCCATAAGG - Intergenic
918176989 1:182055798-182055820 CTTTGGGGGAGTTCATCATAGGG + Exonic
920019759 1:202946561-202946583 CAGTCAGGGAGCACATCATATGG + Exonic
920172902 1:204082649-204082671 CAGTTAGGGAGCCCACCATTGGG - Intronic
921000295 1:211037148-211037170 CTGTGAGGGAGTTCTACAGATGG + Intronic
922044319 1:221928694-221928716 CAGTGAGGTAGTGCACCAACTGG + Intergenic
922593002 1:226792746-226792768 CATTTAGGGAGTTCAAAATAAGG + Intergenic
924592211 1:245414421-245414443 GAATGAGGGAGTTCACGGTAGGG + Intronic
924595732 1:245443285-245443307 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595752 1:245443429-245443451 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595790 1:245443690-245443712 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595803 1:245443778-245443800 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595808 1:245443805-245443827 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595813 1:245443832-245443854 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595818 1:245443859-245443881 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595823 1:245443886-245443908 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595828 1:245443913-245443935 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595849 1:245444059-245444081 CAGTGAGGGAGATGACCGCAGGG - Intronic
924595854 1:245444086-245444108 CAGTGAGGGAGATGACCGCAGGG - Intronic
1063434292 10:6018129-6018151 GAGAGAGGGAGTTCAGCAAAGGG + Intronic
1063550614 10:7029429-7029451 CAGAGAGGAAGTTAACCATTGGG + Intergenic
1063584374 10:7338165-7338187 CAGTGAGGAAATTCACCAAGAGG + Intronic
1063801000 10:9578018-9578040 CAGTCTGGCAGTTCAACATAGGG + Intergenic
1069788623 10:71005443-71005465 CTGTGGGGAAGTTCCCCATATGG + Intergenic
1073064467 10:100750016-100750038 CAGAGAGGGAGATCCCCAAAGGG + Intronic
1076620081 10:131781388-131781410 CAGTGAGTGTGGTCACCAGAAGG + Intergenic
1082117129 11:48340030-48340052 CAGTGCAGGATTTCACCCTAAGG - Intergenic
1082785867 11:57316245-57316267 CAGTGAGAGAGTCCACCAAGTGG - Intronic
1086750222 11:90484415-90484437 CAGTGAAGCAGCTCACCTTAGGG - Intergenic
1090716535 11:129436716-129436738 CAGGGAGGCAGGTCACCACAGGG - Intronic
1091232404 11:133997177-133997199 AAGGGAGGAAGTACACCATATGG - Intergenic
1091872792 12:3908992-3909014 CAGTGAGATGGCTCACCATACGG - Intergenic
1092261599 12:6955959-6955981 GAGTGAGGGAGTTCACAAGGAGG - Intronic
1093489515 12:19688831-19688853 CAGTGAGGGAGTTCACCATATGG - Intronic
1098940594 12:76530403-76530425 AAGTGAGAGAGTGAACCATAAGG - Intronic
1099594464 12:84642212-84642234 CATTAAGGGAGTTCACCAGCTGG + Intergenic
1099622660 12:85024590-85024612 TAGAGAGGGATTTCACCATGTGG - Intronic
1102370214 12:112376740-112376762 GAGGGAGGGAGTATACCATATGG - Intronic
1106282352 13:28286844-28286866 CAGAGGAGAAGTTCACCATATGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108474180 13:50797301-50797323 CACTGAGGGAGTACGACATAAGG + Intronic
1116090565 14:40299569-40299591 GGGTGAGGGAATTCACCATGTGG + Intergenic
1117747105 14:58881049-58881071 GAGGGAGGGAGTTAACCATGCGG + Intergenic
1117798854 14:59422926-59422948 AAGGGAAGGAGGTCACCATAAGG + Intergenic
1118812772 14:69287518-69287540 CAGTGAGGGAGCTCAGGCTACGG - Intronic
1124475219 15:30027128-30027150 CAGTGAGAGAGGTCACTAAAGGG - Intergenic
1125222744 15:37358241-37358263 CAGAGAAGGTGTTCAACATATGG + Intergenic
1131179657 15:90231151-90231173 CCGTGAGGCAGTTCACCAGCCGG + Exonic
1132564312 16:614011-614033 GAGTTAGGCAGTTCACCATCTGG - Intronic
1132564343 16:614223-614245 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564348 16:614254-614276 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564371 16:614403-614425 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564376 16:614434-614456 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564395 16:614553-614575 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564400 16:614584-614606 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564414 16:614676-614698 GAGTTAGGCAGTTCACCATCGGG - Intronic
1132564419 16:614707-614729 GAGTTAGGCAGTTCACCATTGGG - Intronic
1134075755 16:11290337-11290359 CAGTGAGGGAGTTAGTCATGAGG + Intronic
1144444458 17:15314304-15314326 CAGTGAGAGAGGTCCCAATATGG - Intronic
1154928291 18:20962815-20962837 CTCTGAGGGAATTCACCAGATGG - Intronic
1157936984 18:51884053-51884075 CAGTGAGGTAGATCACCATGTGG + Intergenic
1162332336 19:10037986-10038008 CAGTGTGGGACTTCCCCATGAGG + Intergenic
1163074114 19:14873804-14873826 CAGAGAGGAAGGTCTCCATATGG + Intergenic
1164544555 19:29149069-29149091 AAGTGAAGGAGTACACCATATGG + Intergenic
926421338 2:12702683-12702705 CAGTGAGTGGAGTCACCATATGG - Intergenic
926887336 2:17610314-17610336 CAATGAGGGAGTCCACCAAGTGG + Intronic
927345186 2:22030120-22030142 CAGTGAGGCAGATGGCCATATGG + Intergenic
930013717 2:46956773-46956795 CAGTGGGGGTGTTCACCCCAAGG + Intronic
930970999 2:57396421-57396443 CAGTGAGGTAGATCACCAAGTGG - Intergenic
931982957 2:67713809-67713831 CGGTAAGTGAATTCACCATAAGG - Intergenic
932124023 2:69127282-69127304 TAGTGAGGAAGTTAACCATGAGG + Intronic
933196087 2:79391709-79391731 CAGTGATGGAGTTCAACAGGTGG + Intronic
934624499 2:95835412-95835434 CAGTGAGGGACCTCCCAATAGGG + Intergenic
1173644473 20:44625121-44625143 CAGTGAGGCTGTGCACCATGAGG + Intronic
1182883925 22:33757154-33757176 CAGGCATGGAGTTCACCATCTGG - Intronic
1183822622 22:40359014-40359036 CTTTGAGGGAGATGACCATAAGG + Exonic
1184212833 22:43046461-43046483 CAGTCTGGGATTTCACCATTCGG + Exonic
1184967719 22:47993546-47993568 CACTCAGGGAGTGCACCTTACGG + Intergenic
949154944 3:816428-816450 CAGTGAGGCACTGCACCATGAGG + Intergenic
950145030 3:10642869-10642891 CACTGAGGGAGTCTACCAAAGGG + Intronic
950527958 3:13535709-13535731 CAGGGAGAGATGTCACCATACGG - Intergenic
952711363 3:36435373-36435395 GAGTGAGGCAGGCCACCATAAGG - Intronic
953882716 3:46700000-46700022 CAGTCAGGGAGGTCACCCTCGGG - Intergenic
954465254 3:50650638-50650660 CAGACAGGGAGTTCACCTCAAGG + Intergenic
957459002 3:80493238-80493260 CAGAGAGGGTGGTCACCATCAGG - Intergenic
959534548 3:107470287-107470309 CCGTGAGGGACTGCACCATGAGG + Intergenic
961319860 3:126064950-126064972 CAGAGAGGGATTTCACCCAAGGG + Intronic
964726302 3:159817740-159817762 CAATGAGGAATTTCACCAGAAGG - Intronic
968823930 4:2878854-2878876 CAGTGAGGGAGTTCAGAACAGGG + Intronic
970036576 4:11742272-11742294 CAGTGAGGGCTTTCACCCCAGGG - Intergenic
970158439 4:13165190-13165212 CAGTGGGGGAGGTCAGAATAAGG - Intergenic
971418883 4:26457549-26457571 AAGTGAGGAAGTCCACCATGAGG - Intergenic
973230527 4:47835629-47835651 CAGTGGGGGAGGTCAACAGAGGG + Intronic
974070235 4:57116426-57116448 CAGTGAGGGACTTTACCTCAAGG - Intergenic
975043143 4:69769428-69769450 CAGAGAGGGAGTTTACCAAGAGG - Intronic
976722062 4:88178589-88178611 CAGTGAGGTAGAGCACCAAATGG + Intronic
978178360 4:105762188-105762210 CAGTTAGGGTGCCCACCATACGG - Intronic
978671701 4:111255784-111255806 CAATGAGGTAGTTAACCGTAAGG + Intergenic
980823853 4:138050726-138050748 CAGTTGGGCAGTTCACAATAGGG + Intergenic
981143259 4:141295566-141295588 CAGGGAGGAAGTTAACCAAATGG + Intergenic
982355687 4:154465278-154465300 CACTGTGTGGGTTCACCATAGGG + Intronic
982416244 4:155135737-155135759 AAGTGAGGGAGGTGACCAGAAGG - Intergenic
984555202 4:181205359-181205381 CACTGAGGATGTTCACCCTATGG - Intergenic
988298169 5:29391795-29391817 CAGTGAGGCAAGTGACCATATGG - Intergenic
990282357 5:54264727-54264749 GAGTGAGGGAGTTAGCCATGTGG - Intronic
993412486 5:87591123-87591145 CAGTGTGAGTGTTCACCATCAGG - Intergenic
996060912 5:119032259-119032281 AATTGAGGGAGTTAGCCATATGG - Intergenic
998698426 5:144668242-144668264 CTGTGATGGAGTTCAGGATAAGG + Intergenic
1001545566 5:172568649-172568671 CAGTGAGGGAGTTCCCAGCAGGG + Intergenic
1004399218 6:15273060-15273082 CAGTTAGGGGATTCAGCATATGG + Intronic
1006057755 6:31398226-31398248 CAGTGAAAGAGTGCACCAGAGGG - Intergenic
1017942043 6:159061526-159061548 CAGTCAGAGAGTTCGCCGTAGGG - Intergenic
1021142262 7:17041391-17041413 CAGTTAGGGAGTTTACATTATGG + Intergenic
1022297899 7:29073634-29073656 CATTGAGGGAATTTGCCATATGG - Intronic
1024358987 7:48447900-48447922 CAGTGAGGGAGATGAACATTGGG + Intronic
1033015304 7:137664960-137664982 AAGTGAGAGAGTTCACCACGTGG + Intronic
1036814814 8:11894191-11894213 CAGTGAGGAAGAGCACCAAAAGG - Intergenic
1043793717 8:84508279-84508301 CAGTGATTGAGTTAACCCTATGG + Intronic
1045550054 8:103163479-103163501 CAGAGAGGGATGGCACCATAGGG - Intronic
1045624754 8:104030695-104030717 TAGTAAGGGAGTTAGCCATATGG - Intronic
1045689842 8:104748924-104748946 CAGTAAGGGGGTACACCACAAGG - Intronic
1056056400 9:82828502-82828524 AAGTGAACGAGTTCACCAAACGG - Intergenic
1058787124 9:108400488-108400510 CTGTGAGGGAGTTCACTTTTGGG - Intergenic
1060473342 9:123966903-123966925 CAGTGAGGGACTGCAGTATAGGG - Intergenic
1187513804 X:19946818-19946840 AAGTGAGGGTGTTAGCCATAGGG - Intronic
1190297014 X:49033638-49033660 CAGGGAAGGAGTTCCCCATGGGG + Intronic
1193593598 X:83419673-83419695 CAGTGTGGGAGTTCACCACAAGG - Intergenic
1194215069 X:91120498-91120520 CAGTGAGCTAGCTCCCCATAAGG - Intergenic
1196481466 X:116155108-116155130 AAGTGAGGGAGTTGGCCATGTGG + Intergenic
1197189245 X:123627293-123627315 CAGATAGGGAGGTCACCATAGGG - Intronic
1197918643 X:131563763-131563785 AAATGAGGGGGTTCAACATAGGG - Intergenic
1199000295 X:142628379-142628401 CAGTGGGGGAATTCCCCAAAGGG - Intergenic