ID: 1093491203 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:19706733-19706755 |
Sequence | GAGGGTGAAAAATGGGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 3558 | |||
Summary | {0: 1, 1: 5, 2: 116, 3: 754, 4: 2682} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093491196_1093491203 | -10 | Left | 1093491196 | 12:19706720-19706742 | CCAGGGCCTACCTGAGGGTGAAA | 0: 1 1: 5 2: 55 3: 253 4: 538 |
||
Right | 1093491203 | 12:19706733-19706755 | GAGGGTGAAAAATGGGAGGAGGG | 0: 1 1: 5 2: 116 3: 754 4: 2682 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093491203 | Original CRISPR | GAGGGTGAAAAATGGGAGGA GGG | Intronic | ||
Too many off-targets to display for this crispr |