ID: 1093491203

View in Genome Browser
Species Human (GRCh38)
Location 12:19706733-19706755
Sequence GAGGGTGAAAAATGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3558
Summary {0: 1, 1: 5, 2: 116, 3: 754, 4: 2682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093491196_1093491203 -10 Left 1093491196 12:19706720-19706742 CCAGGGCCTACCTGAGGGTGAAA 0: 1
1: 5
2: 55
3: 253
4: 538
Right 1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG 0: 1
1: 5
2: 116
3: 754
4: 2682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093491203 Original CRISPR GAGGGTGAAAAATGGGAGGA GGG Intronic
Too many off-targets to display for this crispr