ID: 1093495296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:19749893-19749915 |
| Sequence | AAAGCATCTAAAATATGCTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1093495296_1093495299 | 7 | Left | 1093495296 | 12:19749893-19749915 | CCATAGCATATTTTAGATGCTTT | No data | ||
| Right | 1093495299 | 12:19749923-19749945 | TAGGATGTACAGAAGGTACATGG | No data | ||||
| 1093495296_1093495298 | 0 | Left | 1093495296 | 12:19749893-19749915 | CCATAGCATATTTTAGATGCTTT | No data | ||
| Right | 1093495298 | 12:19749916-19749938 | AGATACTTAGGATGTACAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1093495296 | Original CRISPR | AAAGCATCTAAAATATGCTA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||