ID: 1093495296

View in Genome Browser
Species Human (GRCh38)
Location 12:19749893-19749915
Sequence AAAGCATCTAAAATATGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093495296_1093495299 7 Left 1093495296 12:19749893-19749915 CCATAGCATATTTTAGATGCTTT No data
Right 1093495299 12:19749923-19749945 TAGGATGTACAGAAGGTACATGG No data
1093495296_1093495298 0 Left 1093495296 12:19749893-19749915 CCATAGCATATTTTAGATGCTTT No data
Right 1093495298 12:19749916-19749938 AGATACTTAGGATGTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093495296 Original CRISPR AAAGCATCTAAAATATGCTA TGG (reversed) Intergenic
No off target data available for this crispr