ID: 1093498086

View in Genome Browser
Species Human (GRCh38)
Location 12:19780058-19780080
Sequence CTGTAGCTGCAGAGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093498080_1093498086 7 Left 1093498080 12:19780028-19780050 CCCAACCTGTGGGAGGTTAGGGT No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data
1093498082_1093498086 2 Left 1093498082 12:19780033-19780055 CCTGTGGGAGGTTAGGGTGTTAT No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data
1093498081_1093498086 6 Left 1093498081 12:19780029-19780051 CCAACCTGTGGGAGGTTAGGGTG No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data
1093498078_1093498086 8 Left 1093498078 12:19780027-19780049 CCCCAACCTGTGGGAGGTTAGGG No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data
1093498076_1093498086 12 Left 1093498076 12:19780023-19780045 CCTTCCCCAACCTGTGGGAGGTT No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data
1093498072_1093498086 21 Left 1093498072 12:19780014-19780036 CCTTCTGTTCCTTCCCCAACCTG No data
Right 1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093498086 Original CRISPR CTGTAGCTGCAGAGGCAGAG GGG Intergenic
No off target data available for this crispr