ID: 1093525852

View in Genome Browser
Species Human (GRCh38)
Location 12:20102665-20102687
Sequence GGCTGCATGCCCTGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093525852_1093525864 29 Left 1093525852 12:20102665-20102687 CCAGCTCCACAGGGCATGCAGCC No data
Right 1093525864 12:20102717-20102739 CATCTTTGCAGAGACCACTCTGG No data
1093525852_1093525858 6 Left 1093525852 12:20102665-20102687 CCAGCTCCACAGGGCATGCAGCC No data
Right 1093525858 12:20102694-20102716 ATGCCTCCCCCTGCTGTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093525852 Original CRISPR GGCTGCATGCCCTGTGGAGC TGG (reversed) Intergenic
No off target data available for this crispr