ID: 1093528469

View in Genome Browser
Species Human (GRCh38)
Location 12:20133252-20133274
Sequence TTCCTATGGAACCCTGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093528469_1093528473 26 Left 1093528469 12:20133252-20133274 CCAGTGACAGGGTTCCATAGGAA No data
Right 1093528473 12:20133301-20133323 AAACCAAATCCAGACCATATTGG No data
1093528469_1093528471 1 Left 1093528469 12:20133252-20133274 CCAGTGACAGGGTTCCATAGGAA No data
Right 1093528471 12:20133276-20133298 TAAAAAATGCTCCAAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093528469 Original CRISPR TTCCTATGGAACCCTGTCAC TGG (reversed) Intergenic
No off target data available for this crispr