ID: 1093528478

View in Genome Browser
Species Human (GRCh38)
Location 12:20133351-20133373
Sequence AGGCATATTAAAAAGCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093528478_1093528482 18 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528482 12:20133392-20133414 CTGAAACCAGTTGTTGAGAGAGG No data
1093528478_1093528488 27 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528488 12:20133401-20133423 GTTGTTGAGAGAGGGAGGTGGGG No data
1093528478_1093528484 22 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528484 12:20133396-20133418 AACCAGTTGTTGAGAGAGGGAGG No data
1093528478_1093528483 19 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528483 12:20133393-20133415 TGAAACCAGTTGTTGAGAGAGGG No data
1093528478_1093528486 25 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528486 12:20133399-20133421 CAGTTGTTGAGAGAGGGAGGTGG No data
1093528478_1093528487 26 Left 1093528478 12:20133351-20133373 CCTTACTGCTTTTTAATATGCCT No data
Right 1093528487 12:20133400-20133422 AGTTGTTGAGAGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093528478 Original CRISPR AGGCATATTAAAAAGCAGTA AGG (reversed) Intergenic
No off target data available for this crispr