ID: 1093529624

View in Genome Browser
Species Human (GRCh38)
Location 12:20145667-20145689
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093529624_1093529630 -5 Left 1093529624 12:20145667-20145689 CCCCCTATCCATGGCTTTTAGAT No data
Right 1093529630 12:20145685-20145707 TAGATGGTAGAAAAGTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093529624 Original CRISPR ATCTAAAAGCCATGGATAGG GGG (reversed) Intergenic
No off target data available for this crispr