ID: 1093529879

View in Genome Browser
Species Human (GRCh38)
Location 12:20148063-20148085
Sequence CTATATAAAAAGAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093529879_1093529883 27 Left 1093529879 12:20148063-20148085 CCTGGCTCCCTCTTTTTATATAG No data
Right 1093529883 12:20148113-20148135 ATTTTATTTTATTTATTTTTAGG 0: 15
1: 39
2: 358
3: 2075
4: 25222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093529879 Original CRISPR CTATATAAAAAGAGGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr