ID: 1093534688

View in Genome Browser
Species Human (GRCh38)
Location 12:20209643-20209665
Sequence CAGTATATACCCATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093534688_1093534690 -8 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534690 12:20209658-20209680 ATATACTGCATTGGTACCTATGG No data
1093534688_1093534697 11 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534697 12:20209677-20209699 ATGGCCGGTTGAGGGATGAGGGG No data
1093534688_1093534692 2 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534692 12:20209668-20209690 TTGGTACCTATGGCCGGTTGAGG No data
1093534688_1093534702 28 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534702 12:20209694-20209716 GAGGGGTGGAAAGTGAAGGGAGG No data
1093534688_1093534701 25 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534701 12:20209691-20209713 GATGAGGGGTGGAAAGTGAAGGG No data
1093534688_1093534698 14 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534698 12:20209680-20209702 GCCGGTTGAGGGATGAGGGGTGG No data
1093534688_1093534693 3 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534693 12:20209669-20209691 TGGTACCTATGGCCGGTTGAGGG No data
1093534688_1093534696 10 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534696 12:20209676-20209698 TATGGCCGGTTGAGGGATGAGGG No data
1093534688_1093534695 9 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534695 12:20209675-20209697 CTATGGCCGGTTGAGGGATGAGG No data
1093534688_1093534700 24 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534700 12:20209690-20209712 GGATGAGGGGTGGAAAGTGAAGG No data
1093534688_1093534691 -4 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534691 12:20209662-20209684 ACTGCATTGGTACCTATGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093534688 Original CRISPR CAGTATATACCCATGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr