ID: 1093534692

View in Genome Browser
Species Human (GRCh38)
Location 12:20209668-20209690
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093534688_1093534692 2 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534692 12:20209668-20209690 TTGGTACCTATGGCCGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093534692 Original CRISPR TTGGTACCTATGGCCGGTTG AGG Intergenic
No off target data available for this crispr