ID: 1093534700

View in Genome Browser
Species Human (GRCh38)
Location 12:20209690-20209712
Sequence GGATGAGGGGTGGAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093534688_1093534700 24 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534700 12:20209690-20209712 GGATGAGGGGTGGAAAGTGAAGG No data
1093534694_1093534700 -7 Left 1093534694 12:20209674-20209696 CCTATGGCCGGTTGAGGGATGAG No data
Right 1093534700 12:20209690-20209712 GGATGAGGGGTGGAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093534700 Original CRISPR GGATGAGGGGTGGAAAGTGA AGG Intergenic
No off target data available for this crispr