ID: 1093534702

View in Genome Browser
Species Human (GRCh38)
Location 12:20209694-20209716
Sequence GAGGGGTGGAAAGTGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093534688_1093534702 28 Left 1093534688 12:20209643-20209665 CCTTGCTTCATGGGTATATACTG No data
Right 1093534702 12:20209694-20209716 GAGGGGTGGAAAGTGAAGGGAGG No data
1093534699_1093534702 -10 Left 1093534699 12:20209681-20209703 CCGGTTGAGGGATGAGGGGTGGA No data
Right 1093534702 12:20209694-20209716 GAGGGGTGGAAAGTGAAGGGAGG No data
1093534694_1093534702 -3 Left 1093534694 12:20209674-20209696 CCTATGGCCGGTTGAGGGATGAG No data
Right 1093534702 12:20209694-20209716 GAGGGGTGGAAAGTGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093534702 Original CRISPR GAGGGGTGGAAAGTGAAGGG AGG Intergenic
No off target data available for this crispr