ID: 1093535350

View in Genome Browser
Species Human (GRCh38)
Location 12:20216884-20216906
Sequence TCTATCAAACAGACTTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093535350_1093535352 16 Left 1093535350 12:20216884-20216906 CCAATGAAAGTCTGTTTGATAGA No data
Right 1093535352 12:20216923-20216945 ATCAATCCATTGCGAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093535350 Original CRISPR TCTATCAAACAGACTTTCAT TGG (reversed) Intergenic
No off target data available for this crispr