ID: 1093538101

View in Genome Browser
Species Human (GRCh38)
Location 12:20247348-20247370
Sequence CAGCCAACACCCACTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093538099_1093538101 11 Left 1093538099 12:20247314-20247336 CCTGTCACGGTGGAGAGCAAAAC No data
Right 1093538101 12:20247348-20247370 CAGCCAACACCCACTCATGAAGG No data
1093538098_1093538101 12 Left 1093538098 12:20247313-20247335 CCCTGTCACGGTGGAGAGCAAAA No data
Right 1093538101 12:20247348-20247370 CAGCCAACACCCACTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093538101 Original CRISPR CAGCCAACACCCACTCATGA AGG Intergenic
No off target data available for this crispr