ID: 1093545363 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:20338746-20338768 |
Sequence | ACTTGGGTTTAGAAGGAAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1093545358_1093545363 | -6 | Left | 1093545358 | 12:20338729-20338751 | CCAGCACATGGAATAGTACTTGG | No data | ||
Right | 1093545363 | 12:20338746-20338768 | ACTTGGGTTTAGAAGGAAGGTGG | No data | ||||
1093545356_1093545363 | 15 | Left | 1093545356 | 12:20338708-20338730 | CCTAACATGTTCACTCTACATCC | No data | ||
Right | 1093545363 | 12:20338746-20338768 | ACTTGGGTTTAGAAGGAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1093545363 | Original CRISPR | ACTTGGGTTTAGAAGGAAGG TGG | Intergenic | ||
No off target data available for this crispr |