ID: 1093545363

View in Genome Browser
Species Human (GRCh38)
Location 12:20338746-20338768
Sequence ACTTGGGTTTAGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093545358_1093545363 -6 Left 1093545358 12:20338729-20338751 CCAGCACATGGAATAGTACTTGG No data
Right 1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG No data
1093545356_1093545363 15 Left 1093545356 12:20338708-20338730 CCTAACATGTTCACTCTACATCC No data
Right 1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093545363 Original CRISPR ACTTGGGTTTAGAAGGAAGG TGG Intergenic
No off target data available for this crispr