ID: 1093550518

View in Genome Browser
Species Human (GRCh38)
Location 12:20404804-20404826
Sequence CTCTGTAACCTACACATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093550518_1093550519 6 Left 1093550518 12:20404804-20404826 CCACACATGTGTAGGTTACAGAG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 1093550519 12:20404833-20404855 TTTTTTTTTTTTTTTTGAGCAGG 0: 422
1: 87887
2: 62562
3: 86971
4: 167546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093550518 Original CRISPR CTCTGTAACCTACACATGTG TGG (reversed) Intronic
900333903 1:2151373-2151395 CTCTGCAACCTTCTCATGTATGG + Intronic
904923100 1:34024135-34024157 CTCTGAAACCTAAAAATGTTGGG - Intronic
906151253 1:43588927-43588949 CTCTGCCAACTACACCTGTGTGG + Exonic
906892990 1:49738456-49738478 CTCTGTAGACTACACCTCTGGGG + Intronic
907614202 1:55907226-55907248 CACTGTAAACTGCACATGTGAGG + Intergenic
908226045 1:62056900-62056922 CTCTGCAACCTCCACCTCTGGGG + Intronic
910080273 1:83333607-83333629 CTGTTTAAACTAGACATGTGTGG - Intergenic
910157355 1:84234384-84234406 CTCTGTAAGCTCCACCTCTGGGG - Intronic
910298150 1:85673817-85673839 CTCTGTAACATACTCATGAATGG - Intronic
912380007 1:109242263-109242285 CTCTGTGACCTCCACATGCAGGG + Intergenic
913931271 1:124967311-124967333 CTCTGTAGGCTCCACATCTGGGG - Intergenic
913933360 1:125008264-125008286 CTCTGTAGGCTCCACATCTGGGG + Intergenic
914448619 1:147771671-147771693 CTCTGTGAACGTCACATGTGTGG + Intronic
915674979 1:157521071-157521093 CTCTGGAAACTACTCCTGTGAGG - Exonic
915675664 1:157527671-157527693 TTCTGGAAACTACTCATGTGAGG - Exonic
915690956 1:157690309-157690331 TTCTGGAAACTACTCATGTGAGG - Exonic
918847395 1:189635164-189635186 CTCAGAAACATACACATATGTGG + Intergenic
921981430 1:221263080-221263102 CTCTGTAAACTCCACCTCTGGGG - Intergenic
922660624 1:227426958-227426980 CACTGTAACCTCCACCTCTGGGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924864240 1:247960530-247960552 CTCTGTAAACTCCACCTCTGGGG - Intronic
1064788335 10:18925109-18925131 CTCTGTAACATAGAAATGTAAGG - Intergenic
1065397267 10:25252784-25252806 CTCTGTAGCCTCCACCTCTGGGG - Intronic
1065463673 10:25996093-25996115 CTCTGTAGACTCCACCTGTGGGG - Intronic
1065853300 10:29809352-29809374 CTCTAAAAACTATACATGTGGGG + Intergenic
1066664215 10:37766158-37766180 CTCTGTAGGCTCCACCTGTGGGG + Intergenic
1067192808 10:44085572-44085594 CTCTGTTACATACACATCTGTGG + Intergenic
1068050794 10:51947058-51947080 CTCTGTAGGCTCCACATCTGGGG - Intronic
1068078965 10:52294393-52294415 CTCTGTGACCAACAGATGTGTGG - Exonic
1069298115 10:66872591-66872613 CACTGTAACCTCCACCTTTGGGG - Intronic
1070829927 10:79411932-79411954 CTCTGTAAGGGGCACATGTGGGG - Intronic
1071699029 10:87909376-87909398 CACTGCAACCTCCACATCTGAGG + Intronic
1072249130 10:93567964-93567986 CTCTGTAATCTGCACATTTCAGG - Intronic
1072361373 10:94663155-94663177 CTCTGTAGACTACACCTCTGGGG - Intergenic
1072373813 10:94793950-94793972 CTCTGTAGACTACACCTTTGGGG - Intronic
1073300288 10:102467111-102467133 CACTGTAACCTCCACCTCTGGGG + Intronic
1074017319 10:109546809-109546831 CTCTGTAGACTACACCTCTGGGG + Intergenic
1074637535 10:115337955-115337977 TACTGTGAACTACACATGTGAGG - Intronic
1075960654 10:126564691-126564713 CTCTGCCTCCTACATATGTGTGG + Intronic
1077158754 11:1103171-1103193 CTCTCTGACCTACACATGTAGGG - Intergenic
1078121683 11:8516883-8516905 CTCTGTAGACTCCACATCTGGGG + Intronic
1078377111 11:10805524-10805546 CACTGCAACCTCCACCTGTGGGG + Intronic
1079174699 11:18128368-18128390 CTCTGTAAACTCCACCTCTGGGG - Intronic
1080810948 11:35703303-35703325 CTCTGTAGGCTCCACCTGTGGGG + Intronic
1081587396 11:44396812-44396834 CTCTGTAGACTCCACATCTGGGG - Intergenic
1082174462 11:49045781-49045803 CTCTGTAGACTCCACCTGTGGGG - Intergenic
1082647625 11:55747969-55747991 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1086691314 11:89790307-89790329 CTCTGTAGACTCCACCTGTGGGG + Intergenic
1086714491 11:90049348-90049370 CTCTGTAGACTCCACCTGTGGGG - Intergenic
1088444932 11:109916178-109916200 CACTGTAACCTCCACCTTTGGGG + Intergenic
1091391159 12:126776-126798 CTCTAGAACCTACACATTTTGGG - Intronic
1093011802 12:14114991-14115013 CTCTGCAATCTACCCATCTGAGG + Intergenic
1093550518 12:20404804-20404826 CTCTGTAACCTACACATGTGTGG - Intronic
1094768056 12:33620268-33620290 CTCTATATTCTACACAAGTGAGG - Intergenic
1094870604 12:34597320-34597342 CCCTGTTACCTGCGCATGTGTGG - Intergenic
1095246427 12:39928984-39929006 CTCTGTCTCCTCCCCATGTGTGG - Intronic
1095591327 12:43907017-43907039 CTCTGTAGGCTCCACCTGTGGGG + Intronic
1096892824 12:54789105-54789127 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
1096955237 12:55518863-55518885 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1096959223 12:55560964-55560986 CTCTGTAGGCTCCACCTGTGGGG + Intergenic
1098307807 12:69118902-69118924 CTCTGGAACCCACACCAGTGAGG + Intergenic
1099455753 12:82860345-82860367 CTGTGTTACCTACACATCTCTGG - Intronic
1101571949 12:105961833-105961855 CACTGTAACCTCCACCTCTGGGG - Intergenic
1104466104 12:128992238-128992260 CATTGTGAACTACACATGTGAGG - Intergenic
1106640927 13:31584080-31584102 CTCTGTAAACTCCACCTCTGGGG - Intergenic
1107115595 13:36742484-36742506 CTGTCTAGCCTACCCATGTGTGG + Intergenic
1109719553 13:66259232-66259254 CTCTGTAGCCTCCACCTCTGGGG - Intergenic
1109754300 13:66738017-66738039 CTCTGTAGCCTCCACCTCTGGGG + Intronic
1110415413 13:75246754-75246776 CTCTGTAAGCTCCACCTCTGGGG - Intergenic
1110729212 13:78860495-78860517 CTCTGTAGACTCCACATCTGGGG - Intergenic
1111364719 13:87227495-87227517 CTTTGTAAGTTACACATGTGGGG - Intergenic
1112811405 13:103223299-103223321 GTCTGTAAGCTACACACCTGAGG - Intergenic
1113348760 13:109507904-109507926 CTCTGTAAACTCCACCTCTGGGG - Intergenic
1113591069 13:111501714-111501736 CTCTGTAGACTCCACCTGTGGGG - Intergenic
1114493827 14:23119235-23119257 CTCTGTCACCCACTCCTGTGTGG + Exonic
1116284896 14:42958702-42958724 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1117489204 14:56229142-56229164 CTCTGTAGACTCCACCTGTGGGG + Intronic
1119809181 14:77501802-77501824 CACTGCAACCTCCACATCTGAGG + Intergenic
1120007320 14:79374030-79374052 CTCAGTAACCTACAGATCTGTGG + Intronic
1120321415 14:82966445-82966467 TTCTGTAACATGCACATTTGAGG + Intergenic
1121356908 14:93223317-93223339 CACTGCAACCTCCACCTGTGGGG - Intronic
1121886235 14:97545683-97545705 CACTGTGAACTGCACATGTGAGG - Intergenic
1122143702 14:99676687-99676709 CTCTCTGACCTGCACCTGTGTGG + Exonic
1124502901 15:30245837-30245859 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1124513385 15:30346801-30346823 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1124729537 15:32183964-32183986 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1124740660 15:32292812-32292834 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1125228778 15:37427685-37427707 CTCTGTAGGCTCCACCTGTGGGG + Intergenic
1126722034 15:51591482-51591504 CTCTGTAGACTCCACCTGTGGGG + Intronic
1129357645 15:75002358-75002380 CTATGTATCCTACACATCTCTGG + Intronic
1131499930 15:92952539-92952561 CACTATGAACTACACATGTGAGG - Intronic
1134689218 16:16180044-16180066 TACTGTAAACTGCACATGTGAGG - Intronic
1138762057 16:59556565-59556587 CACTGTAACCTACACCTCTCGGG - Intergenic
1138782861 16:59809837-59809859 CTCTGTAGTCTCCACATGTGGGG + Intergenic
1139115987 16:63953530-63953552 CTCTGAAACCTGCATTTGTGAGG - Intergenic
1143391607 17:6561985-6562007 CACTGCAACCTCCACATCTGGGG + Intergenic
1145934973 17:28709919-28709941 CACTGCAACCTACACTTCTGGGG - Intronic
1146296191 17:31652525-31652547 CTCTGCAACCTCCACCTGTCAGG - Intergenic
1146600913 17:34215341-34215363 CTCTGTAGACTCCACCTGTGGGG - Intergenic
1147878872 17:43641408-43641430 CTCTGTAGGCTGCACATCTGAGG - Exonic
1149225496 17:54465499-54465521 CTCTGTAGACTCCACATCTGTGG - Intergenic
1149415769 17:56458572-56458594 CTCTGTAACCTACAAAGATTGGG - Intronic
1149932025 17:60766795-60766817 CTCTGTAGACTCCACCTGTGGGG - Intronic
1150182510 17:63139528-63139550 CACTGTAACCTCCACCTGTCAGG - Intronic
1151021662 17:70624308-70624330 ATCTGTAACATTCACATGTCTGG + Intergenic
1151085380 17:71374451-71374473 CACTGCAACCTACACCTCTGGGG + Intergenic
1151308667 17:73280144-73280166 CTCTGTTTCCTAGACCTGTGGGG + Intergenic
1151595022 17:75073175-75073197 CACTGTAACCTCCACCTGTCAGG + Intergenic
1154142188 18:11833956-11833978 CTCTGTTGCCTCCAAATGTGAGG + Intronic
1157109970 18:44811545-44811567 CTCTGTAACCTGTACCTGCGTGG + Intronic
1158978420 18:62734935-62734957 CTTTGTAACCAAGTCATGTGAGG + Intronic
1164111217 19:22161116-22161138 CTCTGTAGACTACACCTCTGGGG - Intergenic
1165801717 19:38555937-38555959 CACTGTAACCTCCACCTGTCAGG + Intronic
1166287897 19:41843675-41843697 CTCTGTAACCCAGAAATCTGTGG + Exonic
1167900441 19:52617653-52617675 CACTGTAACCTCCACCTCTGGGG - Intronic
1168437950 19:56337173-56337195 CTCTGTAGGCTCCACCTGTGGGG - Intronic
925326536 2:3026420-3026442 CTGTGTCTCATACACATGTGGGG - Intergenic
925831356 2:7898944-7898966 CACTGTAACCTACACCTGCCGGG - Intergenic
925913043 2:8585826-8585848 CTCTGCAACTTCCACATGGGTGG - Intergenic
926074712 2:9932771-9932793 CTCTGTAAACTACACCTCTGGGG - Intronic
926551893 2:14311033-14311055 GTCAGTAACCTTCCCATGTGTGG + Intergenic
927004571 2:18834626-18834648 CTCTGTACCTGACACATGTTGGG - Intergenic
927758170 2:25725418-25725440 CTGTTTAACCTTGACATGTGAGG + Intergenic
928001813 2:27529726-27529748 CTCTGTAACCTCCACCTGCTGGG - Intergenic
928331189 2:30359366-30359388 GTCTGCAACCTACACATATAGGG - Intergenic
930262524 2:49164369-49164391 CTCTGAAATCTAGACATGTGGGG - Intergenic
930987619 2:57609371-57609393 CTCTGTAGGCTCCACATCTGGGG + Intergenic
932960057 2:76403089-76403111 CTCTGTTACCTAAATATCTGTGG - Intergenic
933311836 2:80669986-80670008 CTCTTTAACCTCCACTTGTCAGG - Intergenic
933648915 2:84833233-84833255 AGCTGTAACCTAGAAATGTGGGG + Intronic
933662902 2:84942254-84942276 CTCTGCAACTTCCCCATGTGTGG + Intergenic
934591720 2:95557933-95557955 CTCTGTATCCTACACAAGGAGGG - Intergenic
936274074 2:111077928-111077950 TTCTGAAACCTGCACATTTGTGG + Intronic
936728031 2:115346437-115346459 CACTATAACCTACACATGTCAGG - Intronic
936873064 2:117156562-117156584 CTCTGTAGGCTACACCTCTGGGG + Intergenic
937809445 2:126183508-126183530 CTCTGTAGGCTACACCTCTGGGG - Intergenic
937810721 2:126196149-126196171 CTCTGTAAACTCCACCTCTGGGG + Intergenic
938651510 2:133388626-133388648 CTCTGTAGACTCCACCTGTGGGG - Intronic
939157650 2:138544323-138544345 CTCTGTAGACTCCACCTGTGGGG - Intronic
939479280 2:142728391-142728413 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
941100213 2:161286702-161286724 CTCTGTAAACTCCACCTCTGGGG + Intergenic
941523816 2:166581742-166581764 CTCTGTAGACTCCACCTGTGGGG + Intergenic
941564268 2:167087412-167087434 CTCTGTAGGCTCCACCTGTGGGG - Intronic
942952069 2:181732169-181732191 CTCTGTAGACTCCACATCTGGGG + Intergenic
944163619 2:196693189-196693211 CTATATAACCTAGACATGTCAGG - Intronic
946719087 2:222584891-222584913 CTCTGTAGACTCCACATCTGGGG + Intronic
947088800 2:226486602-226486624 TTCTGTCACCTACCAATGTGTGG - Intergenic
1180856564 22:19049749-19049771 CACTGCAACCTACACCTCTGGGG - Intronic
1181617371 22:24064279-24064301 CACTGCAACCTACACCTCTGGGG + Intronic
1184958082 22:47905935-47905957 CTCTGTGAACTGCACATGTGAGG - Intergenic
949187147 3:1205767-1205789 CCTTATCACCTACACATGTGTGG - Intronic
949810020 3:7997145-7997167 CTCTGGTACCTATACATGGGAGG - Intergenic
950346811 3:12302977-12302999 GTCTGTAACTAACACTTGTGGGG - Intronic
950980879 3:17303194-17303216 CTCTGCAACCTCCAGATGTGAGG + Intronic
954537067 3:51368605-51368627 CTCTGTAGCCTCCACCTCTGGGG + Intronic
955153618 3:56393441-56393463 CACTGTATCCTACACAGGTAAGG + Intronic
956519372 3:70086833-70086855 CTCAGTAATTTACACATGTATGG + Intergenic
958191729 3:90193225-90193247 CTCTGTAAACTCCACCTCTGGGG - Intergenic
958413942 3:93852382-93852404 CTCTGTAAACTCCACCTCTGGGG - Intergenic
959178729 3:102951314-102951336 CACTGTAACCTCCACATGCCAGG - Intergenic
959465129 3:106676621-106676643 CACTGCAACCTCCACAAGTGAGG - Intergenic
959725658 3:109538722-109538744 CTCTGTAAACTCCACCTCTGGGG + Intergenic
962541219 3:136384372-136384394 CTCTGTAACCTACACCTCCAAGG - Intronic
970170039 4:13280309-13280331 CTCTGTGAACTGCACATGTGAGG + Intergenic
972677636 4:41276010-41276032 CTCTGTAGCCTCCACCTCTGGGG - Intergenic
972885875 4:43486879-43486901 CACTGTAAACAGCACATGTGGGG - Intergenic
972965298 4:44502013-44502035 CTCTGTAGACTCCACATCTGGGG - Intergenic
972984719 4:44749582-44749604 CTCTGTAGACTCCACATCTGGGG - Intergenic
974305112 4:60126651-60126673 CACTGTAACCTCCACCTCTGGGG + Intergenic
975267098 4:72382857-72382879 CTCTGGAAACTACAAAAGTGGGG + Intronic
975348414 4:73319933-73319955 CTCTGTAAACTCCACCTCTGGGG + Intergenic
976670951 4:87653458-87653480 CTCTGTCACCCAAACAGGTGTGG + Intronic
977110282 4:92944172-92944194 CTCTGTAGACTCCACATCTGGGG - Intronic
978197112 4:105984653-105984675 CTCTGTAGACTCCACATCTGGGG - Intronic
979412137 4:120392619-120392641 CGCTGAAACCTCCACATCTGTGG + Intergenic
979739452 4:124131405-124131427 CTCTGTAAGCTCCACCTCTGCGG - Intergenic
980326439 4:131352929-131352951 CTCTGTAGGCTCCACATCTGGGG + Intergenic
980706988 4:136511104-136511126 CTCTGTAACATAAAAATGTGAGG - Intergenic
981441831 4:144792131-144792153 CTCTGTAGTCTCCACATCTGGGG + Intergenic
982214253 4:153066743-153066765 ATCTGGAACCTCCACATCTGTGG - Intergenic
982279758 4:153671184-153671206 CACTGCAACCTCCACATCTGGGG + Intergenic
984063480 4:175020274-175020296 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
984081045 4:175250408-175250430 TACTTTAAACTACACATGTGAGG - Intergenic
984492224 4:180449529-180449551 CTCTGCAGCCCACAAATGTGTGG + Intergenic
984857695 4:184208761-184208783 CTCTGTAAGCTCCACCTCTGGGG + Intronic
985118629 4:186616729-186616751 CTCTGTAACCTTTTCATGAGGGG - Intronic
985369416 4:189269524-189269546 CTTTGTAACCTAAAAGTGTGAGG + Intergenic
986404693 5:7413632-7413654 TTCTGTTAACTACACATGTTTGG + Intronic
986415724 5:7526076-7526098 CTCTGACACCCACGCATGTGGGG + Intronic
988023641 5:25655445-25655467 CTCTGTAGACTACACCTCTGGGG - Intergenic
988625762 5:32872792-32872814 AACTGTAATCTCCACATGTGGGG + Intergenic
988626129 5:32876647-32876669 CTCTGTGAACTGCACATGCGAGG + Intergenic
989284913 5:39688091-39688113 CTCTGTAGACTACACCTCTGCGG - Intergenic
989656287 5:43748785-43748807 CTCTGTAGGCTCCACATCTGGGG - Intergenic
989953597 5:50330611-50330633 CTCTGTAGGCTCCACATCTGGGG + Intergenic
990860356 5:60320072-60320094 CTCTGTAGACTACACCTCTGGGG - Intronic
991407244 5:66312099-66312121 CTCTGTTACCCACACCTGTGAGG - Intergenic
992252225 5:74886831-74886853 CACTGTAACCTCCACCTCTGAGG + Intergenic
992612463 5:78519348-78519370 CTCTGTACCCTACAAGTGGGTGG + Intronic
993984156 5:94576836-94576858 CTCTGTAACTTACATATTTAAGG - Intronic
994444524 5:99856510-99856532 CTCTGTAGGCTCCACATCTGGGG + Intergenic
994983376 5:106904630-106904652 CTCTGTAGCCTCCACCTCTGGGG - Intergenic
995281988 5:110346174-110346196 ATCTGTAACCTATACCTCTGAGG - Intronic
995665398 5:114536239-114536261 CTCTGTAGACTACACCTCTGGGG - Intergenic
996130934 5:119780233-119780255 CTCTGTAGGCTCCACATCTGGGG - Intergenic
996158498 5:120132471-120132493 CTCTGTAGGCTCCACATCTGGGG - Intergenic
996477901 5:123941915-123941937 CTCTGTAAACTCCACCTCTGGGG + Intergenic
997706780 5:135962203-135962225 CACTGCAACCTCCACCTGTGGGG - Intergenic
1001153185 5:169249943-169249965 TTCTGTTATGTACACATGTGTGG - Intronic
1002685538 5:181006237-181006259 CTCTTTAATCTTCACCTGTGAGG - Exonic
1005583337 6:27253060-27253082 CTGTGTAACCTGCAGATGTTGGG + Intronic
1007629904 6:43267533-43267555 CTCTGTCACCTGCACATGTGGGG + Intronic
1008769523 6:54961957-54961979 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
1010105616 6:72163981-72164003 CTCTGTAAACTCCACCTCTGGGG - Intronic
1010263297 6:73840880-73840902 CTCTGTAAGCTCCACCTCTGGGG - Intergenic
1012209261 6:96499904-96499926 CTCTGTAGACTCCACATCTGTGG - Intergenic
1012317191 6:97795172-97795194 CTCTGTAGACTCCACATCTGGGG + Intergenic
1013465241 6:110412168-110412190 CACTGTAACCTTCACCTCTGGGG - Intronic
1014128456 6:117804542-117804564 CTCTGTAGACTCCACATCTGGGG - Intergenic
1014177460 6:118346296-118346318 TTCTGTAACATACAGTTGTGTGG + Intergenic
1014565640 6:122944993-122945015 CTCTGTAAACTCCACCTCTGGGG - Intergenic
1017476272 6:154796894-154796916 CTCTGTAACCTCCACTTCTGAGG - Intronic
1018437407 6:163775207-163775229 CTCAATAACCAACACAGGTGAGG + Intergenic
1020065938 7:5188801-5188823 CACTGCAACCTCCACCTGTGGGG + Intergenic
1021626913 7:22602662-22602684 TACTGTAAACTGCACATGTGAGG - Intronic
1021993532 7:26158628-26158650 CTCTGTAACCTACTAATGGAGGG - Intronic
1024864929 7:53894670-53894692 CACTGTAACCTCCACCTCTGGGG - Intergenic
1025767786 7:64473092-64473114 CACTGCAACCTACACCTCTGGGG + Intergenic
1027330724 7:77090126-77090148 CTCTGTAGACTCCACATCTGGGG - Intergenic
1027383751 7:77640256-77640278 CACTGTAACCTCCACTTCTGAGG + Intergenic
1028065236 7:86375905-86375927 CTCTGTAAACTCCACCTCTGGGG + Intergenic
1028200498 7:87955722-87955744 CTCTGTAGGCTACACCTCTGGGG - Intronic
1028646954 7:93108851-93108873 CTCTGTAGACTCCACCTGTGGGG + Intronic
1029785040 7:102781214-102781236 CTCTGTAGACTCCACATCTGGGG + Intronic
1030471688 7:109971941-109971963 TTGTGTAACATACACATGTACGG + Intergenic
1030526458 7:110660708-110660730 CTCTGTAGACTCCACATCTGGGG - Intergenic
1031907248 7:127474365-127474387 CTCACTGACCTACACATGTATGG + Intergenic
1032710445 7:134456273-134456295 CACTGCAACCTCCACATCTGGGG + Intronic
1033647897 7:143319102-143319124 CTCTGTCCTCTTCACATGTGGGG + Intronic
1035173602 7:157034355-157034377 CAGTGTCACCTACACCTGTGAGG - Intergenic
1035639467 8:1173478-1173500 CTCTGTAGGCTACACCTCTGGGG - Intergenic
1035867630 8:3101875-3101897 CACTGCAACCTCCACATGCGGGG + Intronic
1037237495 8:16738439-16738461 CTCTCTCACCTGCACATGGGTGG + Intergenic
1039373906 8:37014138-37014160 CTCTCTAACCTGGAAATGTGAGG - Intergenic
1040099028 8:43480597-43480619 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1040410921 8:47153302-47153324 CTCTGTAAACTCCACCTCTGGGG + Intergenic
1040431714 8:47349568-47349590 CTCTGTAGCCTCCACCTCTGGGG - Intronic
1040445131 8:47485404-47485426 CTCTGTAAACTCCACCTCTGCGG + Intronic
1040446928 8:47505222-47505244 CTCTGTAGCCTCCACCTCTGGGG - Intronic
1040608518 8:48959475-48959497 CTCTGTAAACTCCACCTCTGGGG - Intergenic
1041022824 8:53655972-53655994 CTCTGCAACCTTCACCTCTGTGG - Intergenic
1041480456 8:58314643-58314665 CTCTTTAACTTACAGGTGTGTGG - Intergenic
1044134951 8:88574623-88574645 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1044440815 8:92221655-92221677 CTCTGTAAACTCCACCTCTGGGG - Intergenic
1045117544 8:99000161-99000183 TTTTGTATCCTACACATTTGGGG + Intergenic
1045411240 8:101922017-101922039 CACTGTAACCTCCACCTCTGGGG + Intronic
1045842857 8:106599932-106599954 CTATATAAACTGCACATGTGAGG - Intronic
1046781722 8:118222579-118222601 CACTGTAACCTCCACCTCTGGGG + Intronic
1048138696 8:131771436-131771458 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1051727528 9:20103243-20103265 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
1051778065 9:20658248-20658270 CTCTGTAAGCTCCACCTCTGGGG - Intergenic
1052209861 9:25891528-25891550 TTTAGTAACCTAGACATGTGTGG + Intergenic
1053420477 9:37974467-37974489 CTCTGCAGCCTACATCTGTGAGG + Intronic
1054887234 9:70212218-70212240 CTCTGTAGACTCCACCTGTGGGG - Intronic
1058962527 9:110005616-110005638 CTCTGTAAACTCCACCTCTGGGG - Intronic
1061352312 9:130075152-130075174 CTCAGTAACATACACAGCTGTGG - Intronic
1185632954 X:1529180-1529202 CTGCTTAATCTACACATGTGTGG + Intronic
1186041201 X:5480989-5481011 CTCTGTAGGCTACACCTCTGGGG + Intergenic
1190603823 X:52119684-52119706 CTCTGTAGACTCCACATCTGGGG + Intergenic
1190813403 X:53906847-53906869 TTCTGTGAGCTGCACATGTGAGG - Intergenic
1190921698 X:54859525-54859547 CTCTGTAGGCTCCACCTGTGGGG - Intergenic
1191028054 X:55936925-55936947 CTCTGTAAGCTCCACCTCTGGGG + Intergenic
1191685511 X:63885407-63885429 CACTGTCACATACACATGCGTGG + Intergenic
1192909403 X:75587035-75587057 CTCTGTAGGCTCCACATTTGGGG + Intergenic
1192942327 X:75925552-75925574 CTCTGTAGGCTCCACCTGTGGGG + Intergenic
1192955855 X:76069338-76069360 CTCTGTAGGCTCCACCTGTGGGG + Intergenic
1192974438 X:76267940-76267962 CTCTGTAGGCTCCACTTGTGGGG + Intergenic
1193402634 X:81064215-81064237 CTCTGTAGTCTCCACATCTGTGG + Intergenic
1193684071 X:84556081-84556103 CTCTGTAGACTCCACCTGTGGGG + Intergenic
1194803601 X:98300876-98300898 CTCTGTAGCCTCCACCTCTGGGG + Intergenic
1195203775 X:102574839-102574861 CTCTGTAGACTACACTTCTGGGG + Intergenic
1197964225 X:132040061-132040083 GTCTGTAACCTAGTCATGTGAGG + Intergenic
1197988227 X:132290065-132290087 CTCTGTAGCCTCCACCTCTGGGG - Intergenic
1199003388 X:142667658-142667680 ATCTATAACCTAAAAATGTGAGG - Intergenic
1200378502 X:155809307-155809329 CTCTGTAAACTCCACCTGTTGGG + Intergenic
1201590700 Y:15611423-15611445 CTCTGTAAACTCCACCTCTGGGG + Intergenic
1201645402 Y:16224274-16224296 CACTGCAACCTAAACATCTGGGG - Intergenic
1201657411 Y:16361048-16361070 CACTGCAACCTAAACATCTGGGG + Intergenic
1201800000 Y:17944715-17944737 CTCTGTAGACTCCACCTGTGGGG + Intergenic
1201801553 Y:17961241-17961263 CTCTGTAGACTCCACCTGTGGGG - Intergenic
1201915105 Y:19173032-19173054 CTCTGTATACTCCACATCTGGGG + Intergenic
1201923040 Y:19254977-19254999 CTCTGTAGACTTCACATCTGGGG + Intergenic
1201969877 Y:19780199-19780221 CTCTGTAGACTCCACATCTGGGG + Intergenic