ID: 1093554805

View in Genome Browser
Species Human (GRCh38)
Location 12:20459082-20459104
Sequence AAAGAAACACTATACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093554805 Original CRISPR AAAGAAACACTATACTGGGA AGG (reversed) Intronic
902954091 1:19912720-19912742 AAAGAAACAATCTAGGGGGAAGG - Exonic
905628111 1:39501941-39501963 AAAGAAACCCCACACTGGGCCGG + Intronic
906038919 1:42771515-42771537 AAATAAACACTATATTTTGAAGG + Intronic
906931461 1:50173928-50173950 AGAGAAATGCTATGCTGGGAGGG - Intronic
907626441 1:56035037-56035059 AAAATAACACTGTGCTGGGAAGG + Intergenic
908167341 1:61471460-61471482 AAATACACTCTATACTGTGAGGG + Intergenic
909237392 1:73171075-73171097 AAAGAGTAACTATACTGGCAAGG - Intergenic
910747082 1:90585704-90585726 AAAGAAACAAGATACAGAGATGG + Intergenic
911280745 1:95924901-95924923 AAAGTAACACTAAAGTGGGTGGG - Intergenic
911376946 1:97062649-97062671 AAAGAAATATTACACTGGAAAGG + Intergenic
911816822 1:102363310-102363332 AAGGAAACAGCATACAGGGATGG - Intergenic
913548384 1:119892970-119892992 AAAGAAACAGGAGATTGGGATGG + Intergenic
913550676 1:119914638-119914660 AAAGAAACAACATACTTGAAAGG + Exonic
914413231 1:147452506-147452528 AAACAAACAATCTAATGGGAAGG - Intergenic
914835427 1:151202762-151202784 AAAAAAAGACTTTACTGGCAGGG - Intronic
915529478 1:156495001-156495023 GAAGAGACACTAGAGTGGGAAGG - Intronic
915617439 1:157050192-157050214 AAAGAAACACCAGTCAGGGATGG - Intergenic
917410778 1:174758079-174758101 AAGGAAAAACCATACTGGAAAGG - Intronic
917739506 1:177948678-177948700 AAAGAAACAATATAATGTCATGG + Intronic
918433289 1:184484443-184484465 AAACAAAAAGTATTCTGGGATGG - Intronic
918434275 1:184495342-184495364 AAAGATAAACTGAACTGGGATGG - Intronic
918676208 1:187289166-187289188 CAAGAAACAGAATGCTGGGAAGG - Intergenic
920453494 1:206079053-206079075 AAAGAAACTCAAGACTGGGGGGG - Intronic
921158917 1:212459135-212459157 AAGGAAACTCTATAATGGCAGGG - Intergenic
921309647 1:213830265-213830287 AAAGAAAAAACATACTGGGCGGG + Intergenic
921453997 1:215344876-215344898 AAGGAAAAACTAAAGTGGGAGGG - Intergenic
921486842 1:215724978-215725000 AAAGAAACATTCTTCTGTGACGG + Intronic
921901459 1:220455849-220455871 ATAGGAACACTTGACTGGGAAGG - Intergenic
922703072 1:227773340-227773362 AAAGAAAAATTATTCTGGCACGG + Intronic
923471118 1:234291907-234291929 AAAGAAGCACCAGACTGAGATGG + Intronic
924133483 1:240937526-240937548 TAAGAAACATTAAAATGGGAAGG + Intronic
924390285 1:243547723-243547745 TAAGAAACACATGACTGGGAAGG + Intronic
924638201 1:245808709-245808731 AAAAAAGCACTGTCCTGGGATGG - Intronic
1063809892 10:9692810-9692832 AAAAAAATTCGATACTGGGAAGG - Intergenic
1064652923 10:17527569-17527591 AAAGCAACACAAAACTGGGAAGG + Intergenic
1069440193 10:68421456-68421478 AAAGAAAGACTATTTTGGGCCGG + Intronic
1069600086 10:69698990-69699012 AGAGAAACAGTATACTTGAAAGG - Intergenic
1070125314 10:73616892-73616914 AAAGAAAAACTAAAATGGGATGG + Intronic
1070245231 10:74724863-74724885 AAAGAAACACACTACTGGCGAGG + Intergenic
1073962427 10:108948263-108948285 AAAAAAAATCTATATTGGGAAGG - Intergenic
1074047737 10:109854181-109854203 ATATAAACACTATACTCGGCCGG + Intergenic
1075314851 10:121444592-121444614 AAAGAAACACATTTCTGGGTGGG - Intergenic
1075477005 10:122744722-122744744 AAAGAAACATTATGCTAGGCAGG - Intergenic
1078346671 11:10555834-10555856 AAAGACACTCTATCCTGAGAAGG - Intergenic
1078892470 11:15569720-15569742 AAAGAAACTCGACTCTGGGAGGG + Intergenic
1080244299 11:30162508-30162530 AAAGACACATTATATTGAGAAGG + Intergenic
1081120822 11:39263257-39263279 AAAGAAACAATATGCTGGGAAGG - Intergenic
1083555159 11:63620328-63620350 AAAAAAAAATCATACTGGGAAGG + Intergenic
1085752536 11:79174227-79174249 AAACCAACACTCTGCTGGGAGGG + Intronic
1085919032 11:80929410-80929432 AAAGAGAAGCTATACTGTGATGG - Intergenic
1086558454 11:88139879-88139901 AAAGAAACAGAATTCTGGGGAGG - Intronic
1087782045 11:102311412-102311434 AAAGAAAAACTAAAATGGGCTGG + Intergenic
1088084246 11:105958757-105958779 AAAGAAACACTAAATATGGAAGG - Intronic
1090266647 11:125357388-125357410 GAAGAAACACTCTACTGGCCTGG + Intronic
1090596256 11:128324154-128324176 AAAGAAACCCTCGACTGGGACGG - Intergenic
1091009122 11:131982289-131982311 AAAGAAACCCCACACTGGGGAGG - Intronic
1092068074 12:5608941-5608963 AAAATAACAATGTACTGGGAAGG + Intronic
1093258723 12:16905837-16905859 AAAGAAACAAAAAACTTGGATGG + Intergenic
1093554805 12:20459082-20459104 AAAGAAACACTATACTGGGAAGG - Intronic
1095459014 12:42421826-42421848 AGAGGAGCAGTATACTGGGAAGG + Intronic
1095467456 12:42502755-42502777 AAAGAAAAACCTTACAGGGAAGG - Intronic
1096136614 12:49207639-49207661 AACGAAAAACTATTCTGGGCAGG + Intronic
1096247972 12:50005876-50005898 AAGGAAAGCCTTTACTGGGAGGG - Intronic
1097903934 12:64901124-64901146 AGACAAACAATATGCTGGGAAGG + Intergenic
1098495644 12:71132449-71132471 AAAGAAACATTCTACTGCAATGG - Intronic
1098759519 12:74405399-74405421 CAAGCAACATTATACTGGGAGGG - Intergenic
1099126122 12:78760408-78760430 AAAGAAACTCTATATTATGAGGG - Intergenic
1099418867 12:82427430-82427452 AAAAATACACTACACTGGAAAGG - Intronic
1099666964 12:85643543-85643565 AAAAAAACACAAAATTGGGAAGG - Intergenic
1099894862 12:88632433-88632455 AAAGAAACATTTTATTGGGAAGG + Intergenic
1100599120 12:96097846-96097868 AAATAAACAGTATACTGTGGTGG + Intergenic
1101590033 12:106117254-106117276 AAAAGAACACTTTGCTGGGATGG - Intronic
1103543977 12:121686539-121686561 AAAGGAATAGTACACTGGGATGG + Intergenic
1104051961 12:125201111-125201133 AGAGAAACACTTAACTGGGCTGG - Intronic
1104956981 12:132471801-132471823 AAAGAAAAGGTATCCTGGGACGG + Intergenic
1105775037 13:23651825-23651847 AAAAAAAGACTATAGTGTGAAGG - Intronic
1106874701 13:34059015-34059037 AAAAAAACAATGGACTGGGAAGG + Intergenic
1107509102 13:41063655-41063677 AAAGACAGACTACACTGGAAGGG - Intronic
1109706324 13:66097080-66097102 AAAGAAAAAGAAAACTGGGATGG + Intergenic
1109874295 13:68379197-68379219 AAGGAAACATTTTACTTGGATGG - Intergenic
1111128948 13:83949393-83949415 AAAGAAAGACTATAGTGTAAGGG - Intergenic
1111386839 13:87538770-87538792 AGAGAAACACTCTAATGGGATGG + Intergenic
1111675428 13:91381497-91381519 TAAGAAACACAATTCTGTGAAGG - Intergenic
1112743195 13:102497687-102497709 AAAGAAACACTAAAAAGGGTAGG + Intergenic
1113084826 13:106557677-106557699 AAAGAAACAACATACAAGGAAGG + Intronic
1114328196 14:21610986-21611008 AAAGCATCAATATGCTGGGAAGG - Intergenic
1114913170 14:27226439-27226461 GAAGAAACAATACACTGGAATGG + Intergenic
1115493074 14:33977585-33977607 AAAAAAGCACTAGAGTGGGAGGG - Intronic
1116737689 14:48714379-48714401 AAAGAAACACTATGCAATGAGGG + Intergenic
1117725881 14:58673068-58673090 AAAGAGAAACTTGACTGGGAAGG - Intergenic
1118184596 14:63525257-63525279 AAAGAAACATTTTTCTGGAATGG - Intronic
1118289496 14:64506234-64506256 AAAGAAACAGGAAACTGGGCCGG + Intronic
1118297770 14:64585924-64585946 AAAAGAATACTATACTGGCATGG - Intronic
1119615272 14:76094950-76094972 ACAGAAACACAAAACAGGGACGG - Intergenic
1120751213 14:88199940-88199962 AAAGAAACTGTCTATTGGGAAGG - Intronic
1120751254 14:88200585-88200607 AAATAAACCCTACACTGGGAAGG + Intronic
1120882881 14:89428333-89428355 CAAGATACACTATTTTGGGAAGG - Intronic
1121425739 14:93850630-93850652 AAACAAGGACTATACAGGGAGGG - Intergenic
1124011056 15:25838988-25839010 AAATAAATACTATACTGCTATGG - Intronic
1125839604 15:42786798-42786820 AAAGAAACAATAACCAGGGAAGG - Intronic
1126807555 15:52367131-52367153 AATGAAACAATAAACTGAGATGG + Intronic
1127413372 15:58731752-58731774 AAAGAAACACCCTGCTTGGAAGG - Intronic
1128532024 15:68460644-68460666 AAGGAAATACTATACAGCGATGG + Intergenic
1129500345 15:76030765-76030787 AAGGAAACACTATGCCTGGATGG + Intronic
1130536678 15:84790430-84790452 AAAGAAACACAGTCCTGGGGCGG + Intronic
1131165617 15:90140190-90140212 AAATAAAAAATATACTGGCATGG + Intergenic
1132849122 16:2016574-2016596 AATGAAAGTCTATGCTGGGATGG - Intronic
1134773249 16:16829219-16829241 AAAGAAACTCCATAAAGGGAAGG + Intergenic
1140211462 16:72973874-72973896 AAAAAAAAACTCTACTCGGAAGG + Intronic
1140430741 16:74900820-74900842 AAAAATACACTACACTGGGCCGG + Intronic
1140430790 16:74901111-74901133 AAAAAAACTCTATACTGGCTGGG + Intronic
1140644611 16:77015818-77015840 GAAGAAACACTAACCAGGGAAGG + Intergenic
1146301056 17:31690081-31690103 AAATAAAAACTAGACTGGCATGG - Intergenic
1146598644 17:34192107-34192129 AAAGAAATACTATACAGCAATGG + Intergenic
1148467950 17:47876039-47876061 ACAGAAACACTCTAATGGTAGGG - Intergenic
1149721576 17:58850424-58850446 AAGGAAGCACTAAACTTGGAAGG - Intronic
1150951292 17:69804712-69804734 AAAGCACCAGTAAACTGGGAAGG - Intergenic
1151850074 17:76684906-76684928 AAAGAACTCCTAAACTGGGAAGG + Intronic
1153161582 18:2210793-2210815 GAAGGAAAACTTTACTGGGAAGG + Intergenic
1153188944 18:2516863-2516885 AAAGAAACCCAATAATGAGAAGG - Intergenic
1155106792 18:22674962-22674984 AAAGAAACTCTTGCCTGGGAAGG + Intergenic
1155247654 18:23925265-23925287 GAAGAAACACTACAGTGAGAGGG - Intronic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1162243671 19:9380441-9380463 AAAGAAGCCCTTTGCTGGGAAGG + Intronic
1163023216 19:14495004-14495026 AAAGCAACACTGTGCTGGAACGG - Intronic
1163374817 19:16923494-16923516 AAAGAAATTCTGTACTGGGTGGG + Intronic
1164022430 19:21320535-21320557 AAAGAAACATTAGACAGGCATGG + Intronic
1167990252 19:53354504-53354526 AAAGAAACAAAATACAGGGTGGG - Exonic
925506847 2:4575492-4575514 ATAGAAACATTTTTCTGGGAAGG - Intergenic
925659476 2:6187163-6187185 AAAGAAACCCTATTCTTTGATGG - Intergenic
929014133 2:37477116-37477138 AAAGCAAAACTATGTTGGGAGGG - Intergenic
929260999 2:39866476-39866498 AAAGACATCCTATTCTGGGAGGG - Intergenic
930126929 2:47806700-47806722 AAAGAAACAGTAAAAGGGGAAGG + Intronic
930401257 2:50892437-50892459 AAAAACATATTATACTGGGAGGG - Intronic
931422389 2:62140310-62140332 AAAAGAACACAATACTGGAAGGG + Intronic
931735304 2:65188301-65188323 AAAGAAACAAAATACAGGCAGGG - Intergenic
933092601 2:78138959-78138981 AAGGAAACAGAATACTGTGATGG - Intergenic
933910250 2:86934491-86934513 AAAGAAAAACTTATCTGGGAAGG - Intronic
934022477 2:87968918-87968940 AAAGAAAAACTTATCTGGGAAGG + Intergenic
935666067 2:105513883-105513905 AAAAAAACAAAATACTGAGAAGG + Intergenic
935887068 2:107633760-107633782 AAAGAAAGAGTATACTGCAAGGG + Intergenic
936413810 2:112286091-112286113 AAAGAAAAACTTATCTGGGAAGG - Intronic
936507643 2:113120418-113120440 ATAAAAACACTACACTGGCAGGG + Intronic
936723637 2:115285396-115285418 AAAGACAGAGTATACTGGGATGG + Intronic
939073050 2:137566840-137566862 AAAGAAAAACGAAACTGGGTTGG + Intronic
940659681 2:156531456-156531478 AAAGAAACTCTCTACTGTCAGGG - Intronic
941003097 2:160221715-160221737 AAAAACACATTAAACTGGGATGG - Intronic
941418229 2:165248306-165248328 AGAGAAATACTGTAATGGGATGG - Intronic
941783489 2:169474461-169474483 AAAAAAATAATATACTTGGATGG - Intergenic
941846749 2:170141466-170141488 AAAGAAACACTCAACAGGAAAGG - Intergenic
944043769 2:195385331-195385353 AAAGAAACACAATTCTGCCAAGG - Intergenic
944613075 2:201430957-201430979 TAAGAAATACTAGACAGGGAGGG - Intronic
944819408 2:203414728-203414750 AAAGCTACACTATTATGGGATGG - Intronic
945707521 2:213254372-213254394 AAACAAAAAAAATACTGGGATGG - Intergenic
948919963 2:241060645-241060667 AAAAAAAAACTATACAGGGCCGG + Intronic
1169569368 20:6889657-6889679 AAATAATCACTATATTGGGCTGG + Intergenic
1169775415 20:9246865-9246887 TAATAAACACTATTCTGAGAAGG - Intronic
1170540185 20:17379810-17379832 AAGGAAAGACTATCCTGGGTGGG + Intronic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1173430574 20:42983749-42983771 AAAGAAACACGACAGTGGGGTGG - Intronic
1173764657 20:45596490-45596512 AAAGAAACACTAATCTAGGCTGG - Intergenic
1175763212 20:61574990-61575012 GAAGAAACACCACGCTGGGAAGG + Intronic
1178349355 21:31861192-31861214 GAAGAGACACGCTACTGGGATGG + Intergenic
1178977219 21:37230669-37230691 ACAGAAACACTTCACTGGGGTGG - Intronic
1180578125 22:16799919-16799941 AGAGAAACACGATGCTGGAAAGG - Exonic
1182224197 22:28783032-28783054 AAAAAAAAACTATACTCAGAGGG - Intronic
949743013 3:7258137-7258159 CAAGAAACACTATAGTGTGATGG - Intronic
950026620 3:9824703-9824725 AAAGAAAAAGTAAACTGGGACGG - Intronic
950546880 3:13643384-13643406 AAAGAAACACCCTAATGGGGAGG - Intergenic
950975155 3:17233653-17233675 AAAGAAACACTATGTTGTTATGG + Intronic
951186735 3:19722254-19722276 AAAGAAACCCTATATTGTGAGGG + Intergenic
951405665 3:22294176-22294198 AAAGTGCCACTATACTGGGTAGG + Intronic
951625324 3:24655542-24655564 AAAGAAACACTAAACCTAGAAGG - Intergenic
951887590 3:27539242-27539264 AAAAAAAGAGTATACTGGGGTGG + Intergenic
952376651 3:32773156-32773178 AAAGAAACAATCATCTGGGAGGG - Intronic
952474554 3:33694210-33694232 AAAGAAAAAGTCTACTGAGATGG + Intronic
955903655 3:63784362-63784384 AAAGAAAAACAAAACTGTGATGG + Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
957447246 3:80329805-80329827 AAAGTAACACAATCATGGGAGGG - Intergenic
957749617 3:84396379-84396401 GCAGAATCACTATAATGGGAAGG - Intergenic
959265317 3:104130079-104130101 AAAGTAACACTATTCTTGGTGGG + Intergenic
960378801 3:116935047-116935069 AAAGATAGTCTAAACTGGGATGG - Intronic
962257452 3:133882246-133882268 AAAGAAACATAATCATGGGAGGG + Intronic
963226279 3:142865610-142865632 AAAGAAACAACATCCTGTGAAGG + Intronic
964000081 3:151760681-151760703 AAACAAACACAATGCTGGAATGG - Intronic
964061939 3:152536011-152536033 AAAGAAGCACTAAACATGGAAGG - Intergenic
965663159 3:171063718-171063740 AAAGATGGACTGTACTGGGAGGG + Exonic
965696401 3:171412916-171412938 AATGAAACACAAGAATGGGAAGG + Intronic
967129800 3:186459956-186459978 ATGGAAACACCATACTGGGGTGG + Intergenic
968026308 3:195445424-195445446 AAAGAAACATTAAAGTGGGATGG + Intergenic
968429685 4:549646-549668 AAAGAAATAATTGACTGGGAGGG - Intergenic
968982530 4:3858117-3858139 GAGGAAACACTGTACTGGGTGGG - Intergenic
971504991 4:27356899-27356921 AAATAAGCACTTTTCTGGGAAGG - Intergenic
971910657 4:32792733-32792755 AATGAAACACTATGGTGAGAAGG + Intergenic
972883230 4:43450191-43450213 AAAGAAACAAAAGATTGGGATGG - Intergenic
973546565 4:51988555-51988577 AAAGAAGCACTAAACATGGAAGG - Intergenic
973953966 4:56044961-56044983 AAAGAAACCCCACACTGGCAGGG + Intergenic
974256390 4:59460496-59460518 AAAGAATCACAAAACTAGGAAGG - Intergenic
974468217 4:62285287-62285309 AAATAAAAGCTATACTGAGATGG - Intergenic
975679730 4:76864875-76864897 AAAGAAACCCTATACCAGCAGGG + Intergenic
978062637 4:104356701-104356723 AAAGAAAAACAATACTAAGAGGG - Intergenic
978780205 4:112544386-112544408 AAAGAAACAAGATTCTGGGGTGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979893324 4:126128443-126128465 AAGGAAACTATATATTGGGAAGG - Intergenic
983397608 4:167220676-167220698 AAAGAAATACTAGGCTGGGTGGG - Intronic
984249276 4:177311858-177311880 AGAGAATCACTATGATGGGAGGG + Intronic
984288503 4:177763672-177763694 AAAGAATCACTATAGCAGGAAGG - Intronic
985263109 4:188133160-188133182 AAATAAAAACTATACAGGCATGG + Intergenic
986349066 5:6860060-6860082 AAGGAAATACTCTTCTGGGAGGG - Intergenic
987924939 5:24328968-24328990 AAAGAAAAACTAAAGTGGGAGGG - Intergenic
987926972 5:24354117-24354139 TAAGGAACACTATACTGAGTGGG + Intergenic
989189776 5:38659524-38659546 AAAGAAATACTTGACAGGGAAGG + Intergenic
989561354 5:42855694-42855716 AAAGAACCACTAGACTGGAGAGG + Intronic
990568178 5:57051138-57051160 AAAGGAACAGTTAACTGGGAGGG - Intergenic
991518640 5:67468849-67468871 CAAGAAAAACTGTGCTGGGATGG + Intergenic
991714106 5:69435456-69435478 AAAGAAACCCTATATTGGCTGGG + Intronic
992606385 5:78461140-78461162 AAAGAAACACTAAACAGGCTGGG - Intronic
992768587 5:80026214-80026236 AAAGAAACACTATACTTAGAAGG + Intronic
993519192 5:88878592-88878614 AAAGAAAAACTTTCCTTGGAAGG - Intronic
993919937 5:93788882-93788904 AAAGAAACTCTAAATTGGGATGG + Intronic
994192940 5:96888617-96888639 AAAGTAGCTCTATACTTGGAAGG + Intronic
994556376 5:101311176-101311198 AAATAAACACATTAATGGGATGG + Intergenic
995448308 5:112271646-112271668 AAGGACACACAATACAGGGAAGG + Intronic
995623987 5:114056652-114056674 AAAGAAACATTCTCCTGGGTGGG + Intergenic
996376234 5:122810792-122810814 AAAGAAACAGTATAGTATGAGGG + Intronic
996687391 5:126297784-126297806 AAAGAAGCAATATAATGGAATGG + Intergenic
997490632 5:134272794-134272816 AAAGAATTACTATACTTGGCCGG - Intergenic
998500546 5:142628738-142628760 AAAGAATCACTATGTTGGGCGGG + Intronic
998842301 5:146267986-146268008 AAATAAACACTAGAATTGGAGGG - Intronic
999594587 5:153188560-153188582 AAAGAAAGACTACACTCTGATGG - Intergenic
999603251 5:153290116-153290138 AAAATGGCACTATACTGGGAGGG + Intergenic
1000639196 5:163681219-163681241 AAAGAAATATTAGACTGTGAGGG - Intergenic
1000665300 5:163987675-163987697 GAAAATAAACTATACTGGGAAGG + Intergenic
1001270990 5:170311607-170311629 AAGGAAACACTCCCCTGGGAGGG + Intergenic
1001577484 5:172773615-172773637 AAAGAACCATTCTGCTGGGAAGG - Intergenic
1003708125 6:8558285-8558307 AAAGAAGCACTATCCAGGAAAGG + Intergenic
1004077886 6:12361953-12361975 AAAGTGACACTCTAGTGGGAAGG + Intergenic
1007370587 6:41424507-41424529 AAAGAAATGCTAGACTGGGAGGG - Intergenic
1009235329 6:61116424-61116446 AAAGCAAAAATATACTGGGTAGG + Intergenic
1010147301 6:72684989-72685011 AAACAAACAATATAGAGGGAGGG - Intronic
1010306964 6:74335889-74335911 AAAGTAACACAAGACTGGAATGG + Intergenic
1010957874 6:82111649-82111671 AAAAAAAAACTGTACTGGGGAGG + Intergenic
1012538051 6:100323267-100323289 AAACAAACAATATTCTGAGATGG - Intergenic
1014190499 6:118490353-118490375 AAAGAGAAAATATAATGGGATGG + Intronic
1014759736 6:125343332-125343354 AAAGAAAAAGTATGTTGGGAAGG - Intergenic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1016381768 6:143491411-143491433 AAAGATACACTAAATTGTGAAGG - Intergenic
1016442424 6:144097232-144097254 GAAGGAAAACTTTACTGGGAAGG + Intergenic
1016531042 6:145058474-145058496 AAGGTAATACTTTACTGGGATGG + Intergenic
1016859470 6:148702439-148702461 AATGAAACCCAATACTGGGTTGG + Intergenic
1017003577 6:150014084-150014106 AAACATCCACTATAGTGGGAGGG + Intergenic
1019877893 7:3831344-3831366 AAGGAAAAATCATACTGGGAAGG - Intronic
1020425542 7:8061961-8061983 AAAAAAACACTTTAATGGGCTGG - Intronic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1021654088 7:22857824-22857846 AAAAAAAGAATATACTGGGCGGG - Intergenic
1021825356 7:24545481-24545503 AATGAAACTCTGTACTAGGATGG - Intergenic
1023977617 7:45042540-45042562 AAAGAAACACTTTACTCATAGGG + Intronic
1024579377 7:50789551-50789573 AAAGAAACGATATGGTGGGAGGG + Intronic
1025990508 7:66493416-66493438 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1026173282 7:67973387-67973409 AAAGAAAAAGTATACTCTGAAGG + Intergenic
1027213170 7:76166429-76166451 ACAGAAACACTGTGCTGGGTCGG + Intergenic
1027862537 7:83603108-83603130 AAAGAAATACAATATTGGGTTGG - Intronic
1028235413 7:88355293-88355315 AAAGAAAAACAATACTCAGAAGG + Intergenic
1030242674 7:107346229-107346251 AAAGAAAACTTATAATGGGAAGG - Intronic
1030816973 7:114050477-114050499 AAATAAACGCTCTAATGGGAAGG + Intronic
1032054084 7:128671022-128671044 AAAGAAACAGTATACAGTGGTGG - Intergenic
1032072479 7:128816981-128817003 AAGGAAACATGATAGTGGGAGGG - Intronic
1032581713 7:133109209-133109231 TGTGAAACACTATAATGGGAGGG + Intergenic
1033986668 7:147234907-147234929 AAATAATCACAATAATGGGATGG - Intronic
1036194488 8:6701955-6701977 AAATAAACCCTATAGAGGGAAGG + Intergenic
1037218989 8:16493904-16493926 AAAGAAAAACTATCCTGAGAAGG + Intronic
1037871549 8:22502074-22502096 AAAGAAAGATTATCTTGGGAGGG - Intronic
1038151654 8:24946554-24946576 AAAGAAACACTTCACTAGAAGGG + Intergenic
1039094534 8:33869305-33869327 CAAGAGACACTTCACTGGGATGG + Intergenic
1040564527 8:48553772-48553794 AAACTTACACTATACTGTGAGGG + Intergenic
1042275073 8:66996203-66996225 ACAGAAACACTAGACAGGCATGG - Intronic
1042576110 8:70220575-70220597 AAAGTAACAATATTCTGGGAGGG + Intronic
1043228230 8:77762064-77762086 AAAGAAACACTACAATTGTAAGG - Intergenic
1046809137 8:118513914-118513936 AAAGAAATAATAGGCTGGGATGG - Intronic
1050152289 9:2628749-2628771 AAAGATAGACTACACAGGGAGGG + Intronic
1051362288 9:16291842-16291864 AAAGAAAGACTATCCTGAGTGGG - Intergenic
1051408663 9:16766453-16766475 AAATCAACAATCTACTGGGATGG + Intronic
1052484388 9:29077929-29077951 TAAGAAAGACCATACTGGAAAGG + Intergenic
1052604236 9:30678701-30678723 AAAGAATATCTACACTGGGAAGG + Intergenic
1052628534 9:31006734-31006756 AAAGAAGCACTAAACATGGAAGG + Intergenic
1055045554 9:71920501-71920523 AGAGAAACACTATAGTAGGGAGG + Intronic
1055164614 9:73176118-73176140 AAAGAGAGACTTTACTGAGAGGG - Intergenic
1056802281 9:89700744-89700766 AAATAAACAAAATACAGGGATGG + Intergenic
1057326131 9:94065897-94065919 AAAGAAACATTATTCTAGAAGGG - Intronic
1057508641 9:95659215-95659237 AAAGAAACACATTTCTGGCAGGG + Intergenic
1058518466 9:105797887-105797909 TAAGAAACAATATAATGGGGGGG + Intergenic
1060461354 9:123857762-123857784 AAAGAAACATTAAACTGGCCAGG + Intronic
1060565650 9:124588942-124588964 AAAAAAACAGTATAATGTGATGG + Intronic
1061576377 9:131509565-131509587 AAAGAAAAATTCTGCTGGGATGG + Intronic
1062516353 9:136938664-136938686 AAAGAAACACAGCCCTGGGAGGG - Intronic
1185850114 X:3477334-3477356 AAAAAAACATTATAGTGGAATGG - Intergenic
1187237638 X:17483161-17483183 TAAGAAACATTATTCTGAGAAGG - Intronic
1187826664 X:23337924-23337946 AAAAAAAAAATAGACTGGGAGGG + Intronic
1187992119 X:24885817-24885839 AAAGAAACAAGATACTGGCCGGG - Intronic
1188894482 X:35650264-35650286 AAAGAAAAACATAACTGGGAGGG - Intergenic
1190394041 X:49961742-49961764 AAAGAAAAACCATATTGGAAGGG - Intronic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1195501519 X:105606428-105606450 AAAGGAACACTATACACTGAGGG + Intronic
1195581658 X:106510870-106510892 AAATAACTACTATAGTGGGAGGG - Intergenic
1195740879 X:108063490-108063512 AAACAAACAAAATACTGGGCAGG - Intronic
1197323229 X:125059869-125059891 AAAGAAACATATTACTGTGAAGG + Intergenic
1198092976 X:133350224-133350246 AAAGAAAAATGATTCTGGGATGG + Intronic
1198094385 X:133364255-133364277 ATTGAAACCCTATACTGGGGTGG - Intronic
1198842412 X:140872286-140872308 TAAGAAATACCATACTGGGCTGG - Intergenic
1198962550 X:142197653-142197675 AAAGAATAACTATATAGGGATGG - Intergenic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic