ID: 1093554980

View in Genome Browser
Species Human (GRCh38)
Location 12:20461634-20461656
Sequence GGTAATGTATATTAAGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093554980 Original CRISPR GGTAATGTATATTAAGCTTT GGG Intronic
901672165 1:10862248-10862270 GATAATGTATATCCAGCTTATGG + Intergenic
901926103 1:12567215-12567237 GGTGAGGTTTATTAAGCTTGTGG + Intergenic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
902293705 1:15451701-15451723 GGTCATATATATGAAGCCTTGGG - Intergenic
902306166 1:15541112-15541134 TATAATGTATATAAAGCTCTAGG + Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
907640714 1:56187268-56187290 GGTAATGTATTTTAATCACTGGG - Intergenic
908428511 1:64032507-64032529 GGTCATGTCTGTTAAGCTTCAGG - Intronic
908564502 1:65340678-65340700 GATAATCTATATGAAGCATTTGG + Intronic
908965923 1:69762811-69762833 GGTAAAATATATTAAGTCTTTGG - Intronic
909154179 1:72049887-72049909 GGTAATGCATATCAGGCTCTGGG + Intronic
909512783 1:76473883-76473905 TGCAATGTATCTTAAGGTTTAGG - Intronic
909810712 1:79929306-79929328 GGGAATGGATATTAAGCATGTGG + Intergenic
912130198 1:106590309-106590331 GGGAATGGATATTAAGGGTTTGG - Intergenic
912149001 1:106833172-106833194 GGTAAGTTATATTCAGCTTTTGG + Intergenic
912240205 1:107899001-107899023 TCTAATGTATAGTAAGCTTTTGG - Intronic
912858838 1:113195174-113195196 GTTAATGAAACTTAAGCTTTAGG - Intergenic
913072874 1:115316950-115316972 GATAATGAATATTAATATTTAGG + Intronic
914715329 1:150249550-150249572 GATAATGTATATTGGGTTTTTGG - Intergenic
915937930 1:160099611-160099633 GGTAATGTACATAAAGTGTTTGG + Intergenic
916945376 1:169720982-169721004 GATAATGAAAATTAAGCTTCAGG - Intronic
917430465 1:174962246-174962268 GGTAACCTTTATTATGCTTTGGG - Intronic
918510107 1:185303298-185303320 GGTCATGTAAAATAAGGTTTAGG - Intronic
918524634 1:185452098-185452120 GCTAATGAAACTTAAGCTTTGGG + Intergenic
919957185 1:202429757-202429779 GGTAATGTAAACTAAAGTTTAGG + Intronic
922201638 1:223407563-223407585 GGTATTGTATTTTAAAATTTTGG - Intergenic
923120166 1:230982681-230982703 GCTAATGCATACTAAACTTTAGG + Intronic
924391492 1:243565119-243565141 TGAAATGTATATCAAGCATTTGG - Intronic
924723959 1:246650344-246650366 AGTCATGTATATGTAGCTTTTGG - Intronic
1063989154 10:11541364-11541386 GGTAATATACATAAAGCATTTGG - Intronic
1065567064 10:27022536-27022558 GGTAATTTTTAATAAGTTTTGGG - Exonic
1065912349 10:30319664-30319686 ATTAATGTATATTAAGAATTTGG - Intronic
1067460353 10:46453636-46453658 GGCAATGTATATAAAGCATCTGG + Intergenic
1067626837 10:47930967-47930989 GGCAATGTATATAAAGCATCTGG - Intergenic
1068267129 10:54666172-54666194 AGTCTTTTATATTAAGCTTTAGG - Intronic
1068767945 10:60785062-60785084 GGTGATGTAGATTAATATTTGGG + Intronic
1068916446 10:62437336-62437358 GTTGATCTATATCAAGCTTTAGG + Intronic
1070271077 10:74955772-74955794 GGTAATGTATACTCAGAATTAGG - Intronic
1070285455 10:75080253-75080275 GATAATGCATATAAAGCTCTTGG + Intergenic
1070364314 10:75721453-75721475 AGAAAAGTATATTAAGATTTGGG + Intronic
1071543007 10:86504878-86504900 GCTAAAGTATATAAAGGTTTTGG - Intronic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1075019060 10:118935265-118935287 GGTACTGTATTTTAAATTTTCGG - Intergenic
1075769246 10:124919039-124919061 GGTAATATATTTTAAGCTCATGG + Intergenic
1079478934 11:20860696-20860718 GTTAATTTATATAAGGCTTTTGG + Intronic
1080173104 11:29329795-29329817 GGTAAACTAAATTAAGCTCTAGG + Intergenic
1080329043 11:31114353-31114375 GCTAATGAAACTTAAGCTTTAGG - Intronic
1080621985 11:33994375-33994397 GGTAATCTATATTAAACTGCTGG - Intergenic
1080987581 11:37488073-37488095 AATAATTTATATTAAGCTGTTGG - Intergenic
1082805993 11:57450918-57450940 GATAATGTATATAAAGCTTCTGG + Intergenic
1087415458 11:97850132-97850154 GGTAATGAATATTCAGCATAGGG - Intergenic
1088374474 11:109125015-109125037 GATAATTTATATTTAACTTTGGG + Intergenic
1089943251 11:122441090-122441112 GGTAATGTATATGAAGGTGCGGG + Intergenic
1090209959 11:124912044-124912066 GGGAATGGATATTAAGGTGTGGG - Intergenic
1090221904 11:125033865-125033887 GGGAATGGATATTAAGGTGTGGG - Intronic
1090298046 11:125607898-125607920 GATAGTGTATCTTATGCTTTAGG + Intronic
1090314601 11:125774181-125774203 GGTAATTTATTTTAACCTTTGGG + Intergenic
1092947218 12:13467834-13467856 GGAGTTGTAAATTAAGCTTTTGG + Intergenic
1093554980 12:20461634-20461656 GGTAATGTATATTAAGCTTTGGG + Intronic
1094101526 12:26769512-26769534 GTTAATGATTATTAAGCTTATGG + Intronic
1094257605 12:28451191-28451213 GGTAATTGACATTAAGTTTTGGG + Intronic
1095149183 12:38770853-38770875 TCTAATTTATATTAAGCCTTGGG - Intronic
1095603787 12:44043825-44043847 GGGAATGGATATTAAGGGTTTGG + Intronic
1099365645 12:81763182-81763204 GGGAATGGATATTAAGGGTTTGG + Intergenic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1100949710 12:99832976-99832998 GCTAATGCATATAAAGCATTTGG - Intronic
1107490175 13:40874069-40874091 GGGAATGGATATTAAGGTTATGG + Intergenic
1107789668 13:43988983-43989005 CGTAAAATATATTAAGATTTGGG - Intergenic
1108938862 13:55923218-55923240 GGTAATGAAACGTAAGCTTTAGG - Intergenic
1109292924 13:60497866-60497888 GGGAATGTATATTAAGGGTGTGG + Intronic
1109694606 13:65937465-65937487 GGTAATAAATATTAAGCATTTGG - Intergenic
1110464490 13:75785340-75785362 GGCAAAGTTTCTTAAGCTTTTGG + Intronic
1111094343 13:83492480-83492502 GCGAATGTATATTAAGTATTGGG - Intergenic
1111424925 13:88068218-88068240 GGTAATATAAATTAATTTTTAGG - Intergenic
1111453484 13:88449203-88449225 TGAAATTTATATTATGCTTTTGG + Intergenic
1114960089 14:27875866-27875888 TATAATGTATATTTTGCTTTTGG + Intergenic
1115034454 14:28840298-28840320 GGTTATGTTAATTAACCTTTTGG + Intergenic
1115628802 14:35222619-35222641 GGTAGTATATATTATGGTTTTGG - Intronic
1116168558 14:41367321-41367343 TGTAATGAATATTAAGCTCCAGG + Intergenic
1116248880 14:42456005-42456027 GGGAATGTATATTAAGCATATGG + Intergenic
1116449011 14:45043986-45044008 GATAATATATATTAAGATGTGGG + Intronic
1116614041 14:47111105-47111127 GTTAATGTATGCAAAGCTTTTGG - Intronic
1117405114 14:55394375-55394397 GGGTATGTATATTAAGAATTGGG - Intronic
1118070714 14:62244319-62244341 GCTAATGTATATAAGGCTTCTGG - Intergenic
1118113861 14:62752166-62752188 GATAGTGTATATTATGGTTTGGG + Intronic
1118525555 14:66637150-66637172 GGTTATTGATATTAAGATTTTGG + Intronic
1120988056 14:90351368-90351390 GTTAATATATATTAAACATTTGG + Intergenic
1123882524 15:24689275-24689297 GGTAATGTATATTGAGAATAAGG + Intergenic
1125156341 15:36590841-36590863 GGAAAGGTCTACTAAGCTTTGGG + Intronic
1125390731 15:39190085-39190107 CTTCATGTATATTCAGCTTTGGG + Intergenic
1127435577 15:58954587-58954609 TGTAATATATATGAAGCTATTGG - Intronic
1128364605 15:66988858-66988880 GGTAATCTATATAATGCTTCTGG + Intergenic
1130002706 15:80060596-80060618 GATAATTTATATTAAGTTGTTGG + Intronic
1131005956 15:88978653-88978675 GCTAATGAAGCTTAAGCTTTGGG + Intergenic
1133679052 16:8103155-8103177 CTTAATGTTTATTAAGCTTCTGG - Intergenic
1134742509 16:16560359-16560381 GTCAATGTACATTAAGCTCTTGG - Intergenic
1134925050 16:18152100-18152122 GTCAATGTACATTAAGCTCTTGG + Intergenic
1136517483 16:30776701-30776723 GGAAATGTTTATTAAGAGTTTGG - Intergenic
1138745384 16:59357130-59357152 GGTAAAGTGCAATAAGCTTTTGG + Intergenic
1140180102 16:72707513-72707535 GGTAATGTATATGTAGGGTTGGG + Intergenic
1142947454 17:3443909-3443931 TGTATTGTATATTAAAATTTTGG - Intronic
1146305403 17:31726259-31726281 GTTGATATATATTAAGCATTTGG - Intergenic
1146767304 17:35535008-35535030 GATAATGTATGTAAAGTTTTTGG - Intronic
1147507227 17:41030876-41030898 GGTAATCAATATTAAGAATTTGG + Intergenic
1149076299 17:52598982-52599004 GGTACTGTCTAATAAGCATTTGG + Intergenic
1149236307 17:54594521-54594543 GGGAATGGATATTAAGGTATGGG - Intergenic
1153067650 18:1064492-1064514 GGAAATCTATATTAAGGATTGGG - Intergenic
1153586969 18:6632261-6632283 GGGACTGTTTTTTAAGCTTTTGG + Intergenic
1153618698 18:6956376-6956398 GCTGATGTATAATATGCTTTTGG - Intronic
1154018457 18:10641447-10641469 TGTAATGTATAATAACATTTTGG - Intergenic
1154186416 18:12188128-12188150 TGTAATGTATAATAACATTTTGG + Intergenic
1154261622 18:12839480-12839502 GGTAAAGTATAGTGGGCTTTGGG - Intronic
1155404917 18:25477123-25477145 AGTTATGTATATTAAGCTATGGG - Intergenic
1156353450 18:36321531-36321553 GGTAATATGTATTGTGCTTTTGG + Intronic
1156537487 18:37878248-37878270 GGTAATGGATATTAAGGGTGTGG + Intergenic
1159459713 18:68709004-68709026 CGTAATGTATATTTCGTTTTAGG - Intronic
1159674229 18:71261526-71261548 GCTAATGAAGATTAAGCTTCAGG - Intergenic
1161746797 19:6065220-6065242 AATAATGTATTTTAATCTTTGGG + Intronic
1164521490 19:28983335-28983357 GGTAGTGTATAATAGGCTTTGGG + Intergenic
1164779526 19:30881325-30881347 AGTAATGTATATTACTTTTTGGG - Intergenic
1166496986 19:43310521-43310543 GGATATGGAAATTAAGCTTTTGG + Intergenic
926799622 2:16648346-16648368 TGTAATGAATAGTAAGCATTTGG + Intronic
927321669 2:21754464-21754486 AGTACTGTATATTTAGCTTTAGG + Intergenic
928493859 2:31812035-31812057 GTTAATGGATATAAAGCATTTGG + Intergenic
929728084 2:44453932-44453954 GGAAATGGATATAAAGCTTGAGG + Intronic
934981504 2:98846764-98846786 GGTGATGGACATTAAGCTTCGGG - Exonic
935229491 2:101083471-101083493 GGTAATCTTTATAAAGCCTTGGG + Intronic
935790812 2:106588261-106588283 AGCAATGTATATTAAACTTCTGG - Intergenic
935814465 2:106834233-106834255 GGTGATGTATAATTAGCTTCAGG - Intronic
939017314 2:136917877-136917899 GCTAAAGGATGTTAAGCTTTTGG - Intronic
939375123 2:141355430-141355452 GGTTATGTATAGTAGGTTTTTGG - Intronic
941445734 2:165596895-165596917 GATAATGTCTATAAAGCTATTGG - Intronic
941499933 2:166261452-166261474 GGTATTGGATATAAAGCTGTAGG + Intronic
941637208 2:167947505-167947527 GGTAATGTAGGAAAAGCTTTTGG + Intergenic
942381130 2:175392100-175392122 TATTATGTATATGAAGCTTTGGG + Intergenic
944519853 2:200554462-200554484 GGTAATTTATAATCAGCTATAGG - Intronic
944566901 2:201000413-201000435 GCTAAAGCATATTTAGCTTTGGG + Intronic
944923754 2:204441770-204441792 GGGAATGTAAATTTAGGTTTTGG + Intergenic
945226241 2:207533491-207533513 GGTAATATATTGTAAGCATTAGG - Intronic
945556596 2:211283622-211283644 TGTAATATATATTGAGCTATAGG - Intergenic
946618518 2:221535480-221535502 GATAATGTTTATTTAGATTTGGG - Intronic
948103708 2:235395781-235395803 TGTAATTTTTATTTAGCTTTTGG + Intergenic
948274371 2:236696896-236696918 GTTAATGTGTATTAATCATTTGG + Intergenic
1168982609 20:2020742-2020764 GATAATGCATATAAAGCATTTGG - Intergenic
1169364521 20:4980991-4981013 GTTGATGTATATGAAGCTATTGG - Intronic
1170317407 20:15057613-15057635 GTTTATGTATATTATGCATTGGG + Intronic
1177019139 21:15830950-15830972 GTTAAAGGATATTAAGATTTGGG + Intronic
1177252815 21:18617764-18617786 AGTAATTTATTTTAAGTTTTAGG - Intergenic
1177499088 21:21927695-21927717 GGTAATGTTTCTAATGCTTTGGG - Intergenic
1177639565 21:23829457-23829479 AGTAATGTATAATCAGATTTTGG - Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1182191354 22:28463988-28464010 GATCATGTATATTAATTTTTTGG - Intronic
1184618498 22:45655026-45655048 GTAAATGTATGTTTAGCTTTTGG + Intergenic
952179007 3:30898094-30898116 GGGAATGTATAAAAAGCATTTGG - Intergenic
953148581 3:40303162-40303184 GGTAATATATATAAATCTTGTGG + Intergenic
954349825 3:50033967-50033989 GTTTATGTATAATAAGGTTTAGG - Intronic
955896844 3:63709451-63709473 GACAATGTATATAAAGCATTTGG - Intergenic
955966161 3:64391367-64391389 GGTAGTGTATAATAAGGGTTAGG - Intronic
957183541 3:76912758-76912780 GGCAATGTGTATTCAACTTTAGG + Intronic
957975507 3:87438701-87438723 GTTAATGAACATTAAGTTTTTGG - Intergenic
958268808 3:91472535-91472557 GGTAAAGTTTATTCAGGTTTAGG - Intergenic
958921583 3:100112255-100112277 GGTAATGAAAATTTTGCTTTAGG + Intronic
959642007 3:108650349-108650371 GGTACTGGATATTAAGCATAAGG + Intronic
960522570 3:118672358-118672380 GCTAATGTATAGCAATCTTTAGG + Intergenic
963880445 3:150522604-150522626 GGTACTGTATAGTAATGTTTTGG - Intergenic
965461398 3:168969052-168969074 GGTACTGTATATAAAGTATTTGG - Intergenic
966899385 3:184469412-184469434 GATAATGTAGCTTAAGCTTCAGG - Intronic
967410424 3:189161394-189161416 TGTAATGTATTTGAATCTTTTGG - Intronic
971177526 4:24293968-24293990 GTTAATTTATATAAAACTTTTGG + Intergenic
971809553 4:31406601-31406623 GATGATCTATATTAAGGTTTAGG + Intergenic
972254106 4:37335017-37335039 GGTAAAGTAGATTAAGAGTTTGG - Intronic
974374225 4:61056096-61056118 GGTCATTTGTATTAGGCTTTGGG - Intergenic
974744949 4:66060243-66060265 TGTCATGTATATGGAGCTTTCGG - Intergenic
975810136 4:78159556-78159578 GGTAAATCATATCAAGCTTTTGG - Intronic
976034483 4:80798046-80798068 GGAAATGGATATTAAGGGTTTGG - Intronic
976234782 4:82884800-82884822 GTTAATATATATTGAGCTCTAGG - Intronic
976841451 4:89437207-89437229 GGTAATTTTTATTATGATTTTGG + Intergenic
977536050 4:98258273-98258295 GATAATATATATTTTGCTTTTGG - Intergenic
977882258 4:102218542-102218564 GTTATTTTATGTTAAGCTTTTGG - Intergenic
980818769 4:137984538-137984560 GGTAATGTTTACTAGTCTTTTGG - Intergenic
981206856 4:142052477-142052499 AGTATTGTATATTACACTTTTGG + Intronic
981599340 4:146468224-146468246 GCTAATATTTATTAAGCTTATGG - Intronic
982150898 4:152455951-152455973 GGTAACATATATACAGCTTTTGG + Intronic
982551078 4:156800275-156800297 GCTCATATATTTTAAGCTTTTGG - Intronic
987630752 5:20468566-20468588 GGAAATGTAGAAAAAGCTTTTGG - Intronic
988064399 5:26216935-26216957 GGTAATGTATATTATGGTATTGG - Intergenic
989016673 5:36943182-36943204 AGTAAGGTTTAGTAAGCTTTCGG + Intronic
989097481 5:37794720-37794742 GGGAATGGATATTAAGGTTGTGG + Intergenic
990511751 5:56495130-56495152 GAGAATGGATATTAAGCATTTGG - Intergenic
990761345 5:59133418-59133440 GGTAATTTATTTGAAGCATTTGG + Intronic
993050176 5:82917373-82917395 GTTAATATATATAAAGCTCTTGG + Intergenic
993148352 5:84126267-84126289 AATAATGTAGATGAAGCTTTTGG - Intronic
994505434 5:100637791-100637813 GGAAAGGTATTTTAAACTTTAGG - Intergenic
994567100 5:101463630-101463652 GGCCATGTATCTTTAGCTTTGGG + Intergenic
995523180 5:113030032-113030054 GGTAATGTATTTGATTCTTTGGG + Intronic
995776601 5:115729963-115729985 GGGAATGTATATTAAGGGTGTGG - Intergenic
996522131 5:124438706-124438728 TTTAATGTATATGAGGCTTTGGG - Intergenic
996928208 5:128854707-128854729 AGTATTTTAAATTAAGCTTTTGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998837208 5:146213948-146213970 TGTAAGTTACATTAAGCTTTAGG + Intronic
999005261 5:147969256-147969278 GGTAATGTATATAAAGTGTTTGG + Intergenic
999476358 5:151902764-151902786 AGTATTGTAAATAAAGCTTTTGG - Intronic
1000775202 5:165411102-165411124 AATAATGTATATAAAGCGTTTGG + Intergenic
1002182767 5:177440058-177440080 GGTAATGATGTTTAAGCTTTTGG + Intronic
1004025241 6:11811816-11811838 GGAAATATTTACTAAGCTTTTGG + Intergenic
1004499855 6:16199683-16199705 GAAAAGGTGTATTAAGCTTTGGG - Intergenic
1004731451 6:18363453-18363475 GCTAATGTATTTAAAGATTTTGG + Intergenic
1005287475 6:24343616-24343638 GCCAAGGTATATCAAGCTTTTGG - Intronic
1005444838 6:25911557-25911579 GGAATTGTACATTTAGCTTTAGG + Intergenic
1010007851 6:71015117-71015139 GGTAATAAATATTAAGAGTTTGG + Intergenic
1010370885 6:75105954-75105976 GGTGATGGATTTGAAGCTTTTGG - Intronic
1011060885 6:83266076-83266098 GCTAATGTTTATAATGCTTTTGG - Intronic
1011242177 6:85284519-85284541 GGGAATGCATATCAAGCTTTTGG - Intergenic
1012101106 6:95085848-95085870 GTTAATTTACATTTAGCTTTAGG - Intergenic
1013416669 6:109931755-109931777 AGTAATGTGTTTTAAACTTTTGG + Intergenic
1015037374 6:128672513-128672535 GGTAAGGAAAATAAAGCTTTAGG + Intergenic
1015072516 6:129112627-129112649 GATAATGGACATTATGCTTTTGG + Intronic
1015475438 6:133655036-133655058 GGGAATGGATATTAAGTTGTGGG + Intergenic
1015742480 6:136471679-136471701 GGTAATGTAAATGCAGATTTTGG - Intronic
1016582850 6:145648719-145648741 TCTAATGTACATTAAGGTTTAGG + Intronic
1019474578 7:1237734-1237756 GGTAATGTATAATAACCCTTTGG - Intergenic
1020966896 7:14881842-14881864 GGCAATATATACTAACCTTTAGG - Intronic
1022166939 7:27776115-27776137 AGTAATGTAAATTAACATTTAGG + Intronic
1022261091 7:28705610-28705632 GAAAATGTTTATTAAGCTGTAGG + Intronic
1024884643 7:54126925-54126947 GGTAATGGATATTAAGGGTATGG - Intergenic
1025985125 7:66443832-66443854 GGTAATGTCTATTATGCACTAGG + Intergenic
1027863145 7:83611422-83611444 GGTGATATATATTATGCTATAGG + Intronic
1030368257 7:108670670-108670692 GGGAATGGATATTAAGGTATGGG + Intergenic
1030849701 7:114468079-114468101 TGAAATGTACATGAAGCTTTGGG - Intronic
1030962174 7:115938714-115938736 TTTCATGAATATTAAGCTTTGGG - Exonic
1030973804 7:116095472-116095494 GATATTGCATATGAAGCTTTGGG - Intronic
1031122097 7:117733621-117733643 GGTCATAAATATTATGCTTTTGG - Intronic
1033530110 7:142253569-142253591 AGTACTGTATTTTAAGATTTTGG + Intronic
1034742849 7:153494876-153494898 GGTGATTAATATTAGGCTTTTGG - Intergenic
1035413399 7:158664463-158664485 TGTAATTTGTATTATGCTTTTGG + Intronic
1035975376 8:4304748-4304770 TGTAATGTATATTTATTTTTTGG - Intronic
1037351253 8:17960160-17960182 GGCAAGGTATGTTAAGCTTTTGG + Exonic
1039981009 8:42410054-42410076 GATAATGAATATTAACATTTTGG - Intergenic
1041670399 8:60486075-60486097 GCTAATAAAAATTAAGCTTTGGG + Intergenic
1042280065 8:67046392-67046414 AGTAATGCATATAAAGTTTTTGG + Intronic
1042330701 8:67577374-67577396 GCTAATGAAGCTTAAGCTTTAGG - Intronic
1043257716 8:78157109-78157131 GGGAATGTATATTAAGGGTGTGG + Intergenic
1044027405 8:87190626-87190648 GGTAATGACGCTTAAGCTTTAGG + Intronic
1045704754 8:104909203-104909225 GATAATGTATATTAAGTACTTGG + Intronic
1046507164 8:115150872-115150894 GATATTGTATATGAAGCTTCAGG - Intergenic
1047260105 8:123249052-123249074 GATAATAAATATTAAGCTCTTGG - Exonic
1047565032 8:126034832-126034854 GGGAATGGATATTAAGGTTGTGG - Intergenic
1051411777 9:16797133-16797155 AAAAATCTATATTAAGCTTTAGG - Intronic
1052184303 9:25572684-25572706 GGGAATTTATATTAAACTTTTGG - Intergenic
1058281575 9:103122661-103122683 GGTAATTTATATAATGCTTCAGG + Intergenic
1059555315 9:115275368-115275390 GGTATTGTAATCTAAGCTTTTGG + Intronic
1059835447 9:118147016-118147038 GATAATGTCTATAAAGTTTTTGG + Intergenic
1187143838 X:16619803-16619825 GGAAATTTACATTAAGCTTGAGG - Intronic
1188103659 X:26122372-26122394 AATAATGTATGTTAAGCTTTAGG + Intergenic
1188125450 X:26362641-26362663 GGTAAAATATACAAAGCTTTGGG + Intergenic
1188702610 X:33283142-33283164 TTAAATGTATATTTAGCTTTTGG - Intronic
1194604687 X:95964271-95964293 GGTAATGGATATTAAGGGTGTGG - Intergenic
1196114709 X:111986334-111986356 GGGAATGGATATTAAGAATTTGG - Intronic
1199813341 X:151372454-151372476 GCTAATCTATATGATGCTTTAGG - Intergenic
1202576683 Y:26334774-26334796 GGTAATGTAAACTAAAGTTTAGG - Intergenic