ID: 1093555698

View in Genome Browser
Species Human (GRCh38)
Location 12:20471026-20471048
Sequence CTTGAAATCCAAGATCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093555698 Original CRISPR CTTGAAATCCAAGATCTAGG TGG (reversed) Intronic
900791893 1:4686297-4686319 CTAGAAGTCCAAAATCAAGGTGG + Intronic
901302949 1:8212814-8212836 CTGGAAATACAAGCTCCAGGAGG + Intergenic
902735788 1:18399695-18399717 CAGGAAACCCAAGACCTAGGAGG - Intergenic
903236402 1:21953260-21953282 CATGAAATCCTAGAGCTGGGAGG + Intergenic
909384198 1:75036699-75036721 CTTGAAACCCAGGACCTTGGTGG - Intergenic
909568045 1:77077632-77077654 CATCAAATCCAAGATCTTGAAGG + Intergenic
910043081 1:82877352-82877374 CTTAAAAGCCAAGATGTAGAGGG + Intergenic
910092257 1:83479213-83479235 CTAGAAGTCCAAGATCAAGGTGG + Intergenic
911592707 1:99766361-99766383 CTTTAATTCCAAGATATGGGTGG - Intronic
913067126 1:115266485-115266507 CGTGAATTCCATGATCCAGGTGG + Intergenic
913468084 1:119163709-119163731 CTGGAATTCCAAGATCAAGGTGG - Intergenic
915649041 1:157294267-157294289 CTTGAAATCCAGGACCCTGGTGG - Intergenic
918550739 1:185739394-185739416 CTTGAAATACAACATTGAGGAGG + Intronic
1063232681 10:4081178-4081200 CCTGTAATCCCAGAACTAGGAGG + Intergenic
1064260721 10:13784027-13784049 GTTGAAATGCAACATCTTGGAGG + Intronic
1064279303 10:13936645-13936667 TGTGAAGTCCAAGATCAAGGTGG - Intronic
1064354820 10:14606840-14606862 CTGGAAGTCCAAGATCAAGATGG - Intronic
1064771711 10:18730199-18730221 CTCGAAGTCCAAGATTAAGGGGG + Intergenic
1065002780 10:21352302-21352324 CTGAAAATCCAAGATCAAGGTGG + Intergenic
1066294448 10:34042117-34042139 CTTGGGATCCAAGAACTGGGGGG + Intergenic
1067332316 10:45333730-45333752 CTTGAAACCCAAGACCCTGGTGG + Intergenic
1067352635 10:45490489-45490511 CTGGAAGTCCAAGATGAAGGTGG - Intronic
1068193023 10:53678311-53678333 CTTGAAATTCTAGACATAGGAGG - Intergenic
1068992872 10:63168586-63168608 CGTGAAATACAAGTTTTAGGAGG + Intronic
1069004909 10:63306484-63306506 CTAGAAGTCTAAGATCAAGGTGG + Intronic
1069568969 10:69482934-69482956 TTAGAAGTCCAAGATCAAGGTGG + Intronic
1070142845 10:73751435-73751457 CTTGAAATCCCAGACTTGGGAGG + Intronic
1070688860 10:78510031-78510053 CTGGAAGTTCAAGATCAAGGTGG + Intergenic
1071932884 10:90493572-90493594 AATGAAAACCAAGAGCTAGGAGG - Intergenic
1072404364 10:95136220-95136242 CTTGAAATCCAGGGTCCTGGTGG - Intergenic
1072578209 10:96719350-96719372 CTTGAAAAAGAAAATCTAGGTGG - Intronic
1073672937 10:105612788-105612810 ATGGAAGTCCAAGATCAAGGTGG + Intergenic
1075868130 10:125745251-125745273 CTGGAAGTTCAAGATCAAGGTGG + Intronic
1076591731 10:131588207-131588229 CTTGAGATCCAGCAACTAGGGGG - Intergenic
1078294348 11:10051886-10051908 TTTGAAATCCAAATTCTATGAGG - Intronic
1078421730 11:11218172-11218194 GTTAAAATCTAAGATCGAGGAGG + Intergenic
1079570112 11:21932507-21932529 CTTGAAATCGCAAATCGAGGTGG + Intergenic
1080102182 11:28472393-28472415 CTTGAAATCCAACACCAAGGTGG - Intergenic
1080710017 11:34737860-34737882 CTTGAAATCCAGGGTCCTGGTGG - Intergenic
1083241792 11:61393936-61393958 CTTCAATTCCAAGATAAAGGAGG - Exonic
1083346700 11:61998434-61998456 CTAGAAATACAAATTCTAGGAGG + Intergenic
1085494478 11:76955455-76955477 TTGGAAGTCCAAGATCAAGGTGG + Intronic
1088028213 11:105213173-105213195 CTTAAAGTTCAAGATCAAGGTGG + Intergenic
1090090918 11:123696961-123696983 CTAGAAGTCCAAGATCAAGGTGG - Intergenic
1090725139 11:129518220-129518242 CTTGAAATCCAGGACCCTGGTGG + Intergenic
1091811283 12:3400002-3400024 CTAAGAATCCAACATCTAGGAGG + Intronic
1093555698 12:20471026-20471048 CTTGAAATCCAAGATCTAGGTGG - Intronic
1094305138 12:29010211-29010233 CTAGAAGTCAAAGATCAAGGTGG + Intergenic
1095930887 12:47624175-47624197 CTTGAAACCCAGGGTCCAGGTGG - Intergenic
1099238972 12:80116155-80116177 CTTGAAACCCAAGGCCTTGGTGG + Intergenic
1101133960 12:101720152-101720174 CTAGAAATCCAAGAACTGGAAGG - Exonic
1101439518 12:104692991-104693013 CTGGAAGTCCAAGATCAAGGTGG + Intronic
1101825920 12:108219821-108219843 CATGAAATCCTAGAGCTTGGAGG - Intronic
1102333014 12:112051465-112051487 CTTGTAATCCAAGCACTGGGAGG - Intronic
1103029502 12:117601278-117601300 TTTAGAATCCAAGATCTTGGGGG + Intronic
1103679441 12:122681596-122681618 CTGGAAGTCCAAGATCAAGGCGG - Intergenic
1105059797 12:133138727-133138749 CTTGAAAAGCAAGCTCTATGAGG + Intronic
1105825197 13:24116167-24116189 TGGGAAATCCAAGATCAAGGTGG + Intronic
1106782720 13:33075853-33075875 CTGGAAGTCTAAGATCAAGGTGG + Intergenic
1108529627 13:51316781-51316803 CTAGAAGTCCAAGATCAAGCTGG - Intergenic
1110572207 13:77017544-77017566 ATAGAAATCCAAAATTTAGGAGG + Intronic
1110865137 13:80385261-80385283 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
1112082330 13:95986418-95986440 CTTGAAAACTAAGATCTGGAAGG + Exonic
1112590468 13:100759601-100759623 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
1113011348 13:105770621-105770643 GTTAGAAGCCAAGATCTAGGAGG + Intergenic
1113207559 13:107934652-107934674 CTTTAAATGCAAGATTTAGAAGG + Intergenic
1113370135 13:109716809-109716831 CCAGAAGTCCAAGATCCAGGTGG + Intergenic
1115363846 14:32533995-32534017 CTTGAAACCCAAGAACTAATTGG - Intronic
1115582635 14:34776863-34776885 CTGGAAGTCCAAGATCAAGCAGG - Intronic
1119154047 14:72392298-72392320 CTTGAAGTCCAAGAGGCAGGTGG + Intronic
1119824805 14:77648775-77648797 CTGGAAATCCAAGATCCAAGAGG + Intergenic
1119914247 14:78382507-78382529 CTTGCAATGCTAGATCTATGTGG - Intronic
1120369050 14:83608116-83608138 CTTGGAATCCAAGACCCTGGTGG + Intergenic
1120513278 14:85440837-85440859 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
1122045882 14:99023062-99023084 TGGGAAATCCAAGATCAAGGTGG - Intergenic
1122187423 14:100010973-100010995 CTTGAAATCCAAAGTTGAGGAGG - Intronic
1124513909 15:30350101-30350123 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
1124622428 15:31281676-31281698 CTGGAAGTCCAAGATCAGGGTGG + Intergenic
1124729012 15:32180664-32180686 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
1124793598 15:32753872-32753894 CTGGAAGTCCAAGATCAGGGAGG - Intergenic
1127007775 15:54589859-54589881 CATGAAATCCTATATATAGGAGG + Intronic
1129263820 15:74383410-74383432 CTGGCAATACAAGATCTAGGAGG + Intergenic
1129576894 15:76759311-76759333 CTGGAAGTCCAATATCAAGGTGG + Intronic
1132032140 15:98446963-98446985 CTGGACGTCCAAGATCAAGGTGG + Intronic
1134596403 16:15499484-15499506 ATAGAAGTCCAAGATCTAAGAGG - Intronic
1134629014 16:15743560-15743582 CTTGAAAACAAAGAGTTAGGAGG - Intronic
1135299645 16:21314543-21314565 TGTGAAGTCCAAGATCAAGGTGG + Intergenic
1137072380 16:35914759-35914781 AATGAAATCCAAGATGTTGGAGG + Intergenic
1137522015 16:49202534-49202556 CTGGAAGTCCAAGGTCCAGGTGG - Intergenic
1137573754 16:49584583-49584605 CTGGAAGTCCAAGATCAAGGTGG + Intronic
1138945339 16:61842474-61842496 TGGGAAGTCCAAGATCTAGGTGG - Intronic
1139090398 16:63639287-63639309 CTTGAAATTTAACATCTAGTTGG + Intergenic
1140763180 16:78130410-78130432 CTTAAAGTCCAAGGTCAAGGTGG - Intronic
1142138847 16:88463645-88463667 CTTGAGCTCCTAGATCTGGGCGG + Intronic
1144157195 17:12517279-12517301 ATTGAAATTCAAGATCTGAGGGG - Intergenic
1144592656 17:16537590-16537612 CCTGAATTCCCAGACCTAGGTGG - Intergenic
1147533331 17:41300577-41300599 CTTGAATCCCTAGATATAGGTGG - Intergenic
1149282590 17:55124772-55124794 CTAGAAGTCCAAGATCAAGGTGG + Intronic
1149951546 17:60993154-60993176 CGTGGAATACAAGATCTATGAGG - Intronic
1150428852 17:65100144-65100166 CTTGAGATCCTACAGCTAGGTGG + Intergenic
1150511495 17:65757148-65757170 CTAGAAGCCCAAGATCAAGGTGG - Intronic
1153171909 18:2326507-2326529 CTTGAAGTCTAAGATTTAGGAGG + Intergenic
1155744077 18:29329335-29329357 GTTGAAAACCAAGATCTTGAAGG - Intergenic
1156423335 18:36980128-36980150 GGTGAAATCCAAGATCAAGATGG - Intronic
1157413574 18:47483957-47483979 TTTGAAATAAATGATCTAGGTGG - Intergenic
1158963986 18:62607880-62607902 CTGGAAGTCCAAAATCAAGGTGG + Intergenic
1159601716 18:70434127-70434149 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
1163053808 19:14704000-14704022 CTGGAAGCCCAAGATCAAGGTGG + Intronic
1163630140 19:18414178-18414200 TTAGAAATCCCAGGTCTAGGAGG - Intergenic
1166659228 19:44635053-44635075 CTGGAAGTCCAAGATCAAGGTGG + Intronic
1167084106 19:47297325-47297347 TTAGAAATGCAAGATCTTGGCGG - Intronic
1167497345 19:49827400-49827422 CTGGAAGTCCAAAATCCAGGTGG + Intronic
1168304522 19:55428326-55428348 CTGGAAGTCCAAGATCAAGGAGG - Intergenic
925400753 2:3570567-3570589 CTGGAAGCCCAAGATCAAGGTGG - Intergenic
926398933 2:12475422-12475444 CTAGAAGTCCAAGATCAAGGGGG - Intergenic
926577529 2:14598500-14598522 CTTGAAATCAAGGAGCCAGGTGG - Intergenic
927799802 2:26087998-26088020 CTTGAAATCCAATGCCTAAGCGG + Intronic
928245131 2:29620214-29620236 CTGGAAGTCCAAAATCAAGGTGG + Intronic
930334606 2:50029235-50029257 CTAGAAGTCCATGATCAAGGTGG - Intronic
930722140 2:54648031-54648053 CTTGATATCGAAGAGTTAGGAGG - Intronic
930828926 2:55722441-55722463 CTTGGCATCCAAGACCTTGGTGG - Intergenic
931324251 2:61202001-61202023 CTGGAATGCCAAGATGTAGGGGG - Intronic
934098583 2:88629491-88629513 CTAGAAGTCCAAGATCAAGGTGG + Intergenic
934522335 2:95027059-95027081 CTTGAAATCCTAGGGATAGGCGG + Intronic
934723637 2:96600923-96600945 CTTGAACTCCAAGGTTTAAGTGG - Intronic
935104657 2:100029398-100029420 CTGGAATTCCATGATCAAGGTGG - Intronic
939892390 2:147752618-147752640 CTAGAAGTCCAAGATCAGGGTGG + Intergenic
940079602 2:149785425-149785447 ATTAAAAACCAAGATCTGGGTGG + Intergenic
940418422 2:153449682-153449704 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
942386915 2:175452300-175452322 CTGGAAATCCAAGATCAAGGTGG - Intergenic
943090763 2:183372172-183372194 ATTGAAATGCAAGACCTATGAGG + Intergenic
944290809 2:198002342-198002364 CTTGAAATCAAATTTCTGGGTGG + Intronic
947308953 2:228779138-228779160 CTGGAAGTCCAAGATCAGGGTGG - Intergenic
948322051 2:237078218-237078240 CTTGAAAACAAAGAACTATGAGG - Intergenic
1169034465 20:2438279-2438301 CTTAAGATCCAAGTTCCAGGAGG - Intergenic
1169518999 20:6351025-6351047 CTAGAAAACAAACATCTAGGTGG - Intergenic
1171804700 20:29664659-29664681 TGGGAAGTCCAAGATCTAGGTGG - Intergenic
1173530095 20:43762661-43762683 CCTGTAATCCAACATCTTGGGGG - Intergenic
1173896381 20:46554131-46554153 CTTGAATTGCATGATCTGGGAGG - Intergenic
1177239076 21:18432713-18432735 CTGGAAATCCAAAATCTACGTGG - Intronic
1177915887 21:27087747-27087769 CTAGAAGTCCAAGATTGAGGTGG - Intergenic
1178630417 21:34254853-34254875 ATTAGAAACCAAGATCTAGGTGG + Intergenic
1178747308 21:35265411-35265433 CTGGAAATCCAAGATCAGGGTGG - Intronic
1184261492 22:43319720-43319742 CTGGCAGTCCAAGATCGAGGTGG - Intronic
1184377969 22:44126613-44126635 CTTCACATCCAAGATCAAAGAGG - Intronic
949549249 3:5098550-5098572 CTTGAAGTCCAAGACCAAGAGGG - Intergenic
949691485 3:6644857-6644879 TTTGAAGTCCAAGATGAAGGTGG - Intergenic
949890041 3:8726921-8726943 CTGGACATCCGAGATCAAGGTGG + Intronic
950361362 3:12451725-12451747 CTGGAAGGCCAAGATCAAGGTGG - Intergenic
950481716 3:13248214-13248236 CTGGAAATCCAGCATCTACGTGG + Intergenic
950743313 3:15066663-15066685 CATGAAATCACAGATCCAGGAGG - Intergenic
950817733 3:15724381-15724403 CATCAACTCCAAGATCTAGAAGG + Exonic
951912717 3:27768334-27768356 CTTGAAATACAAGTCCTAGGTGG - Intergenic
952608010 3:35173048-35173070 CTTGAAACCCAGGACCTTGGTGG + Intergenic
952745773 3:36777234-36777256 CTTAAAATTCAAGGTGTAGGAGG - Intergenic
953286598 3:41616664-41616686 CTTGAAACCCAGGACCTTGGTGG - Intronic
955656266 3:61248129-61248151 TTTGAAATATAAGATGTAGGAGG - Intronic
956157376 3:66312605-66312627 CTTGAAACCCAAGACCCTGGTGG + Intronic
957023141 3:75147035-75147057 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
957526975 3:81390473-81390495 CTAGAAGTCCAAGATCAAGGAGG + Intergenic
957676702 3:83377029-83377051 ATGGAAATCCAAGATCCAGAGGG + Intergenic
957679664 3:83417610-83417632 CTAGAAGTTCAAGATCAAGGTGG - Intergenic
959087504 3:101867228-101867250 CTTGAAAACCTAGATGTGGGTGG - Intergenic
959500242 3:107098634-107098656 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
959513942 3:107244768-107244790 CTAGAAGTCCAAGATCAAGATGG + Intergenic
960251060 3:115453909-115453931 ATTAGAATCCAAGATCTTGGTGG + Intergenic
962168845 3:133079440-133079462 CTGGAAGTCCAAGATCAAGGTGG + Intronic
963985748 3:151592456-151592478 CTTGTCCTCCAAGTTCTAGGGGG + Intergenic
965655087 3:170975387-170975409 CTTGAAACCCAGGGTCTTGGTGG + Intergenic
965955245 3:174361695-174361717 CTAGAAATCCAAGATCAAAATGG - Intergenic
967743467 3:193028922-193028944 CTTGAATTTCAAGCTCTAGGAGG - Intergenic
969538483 4:7771022-7771044 ATTGGAATCCAAGGGCTAGGAGG - Intronic
971192091 4:24437439-24437461 CTTGGTATCCAAGATTTAGAAGG + Intergenic
971571764 4:28221471-28221493 CTTGTAACTCAAGATATAGGCGG + Intergenic
971637417 4:29079384-29079406 CTAGAAGTCCAAGATCAAGGTGG + Intergenic
971769248 4:30875134-30875156 CTAGAAATCCAAAATCAAGGTGG + Intronic
972698542 4:41471613-41471635 CATTAAATCCAATCTCTAGGAGG - Intronic
976273587 4:83253714-83253736 ATTAAAATGCAAGTTCTAGGAGG + Intergenic
977211665 4:94225240-94225262 TTTGAAGTCCAAGATCAAGTTGG + Intronic
979970241 4:127125677-127125699 ATTAAAATCCAAGATCTTGCAGG - Intergenic
983261691 4:165463918-165463940 CTAGAAGTTCAAGATCAAGGTGG + Intronic
985090262 4:186355375-186355397 CTAGAAATCCAAAATCAAGGTGG + Intergenic
986762307 5:10891341-10891363 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
987340092 5:16932258-16932280 GTTCAAATACAAGATCTCGGAGG - Intronic
988058211 5:26129101-26129123 TTTAAAATCCAACATCTTGGCGG + Intergenic
988108460 5:26781709-26781731 CTGGAATTCCAAGATCAAGAGGG + Intergenic
990651067 5:57899945-57899967 CTGTAAGTCCAAGATCAAGGTGG - Intergenic
991455351 5:66797620-66797642 TGGGAAATCCAAGATCAAGGTGG + Intronic
994957135 5:106546323-106546345 CATGGAGTCCAAGACCTAGGGGG - Intergenic
995811189 5:116108800-116108822 CTTGAAACCCAGGGCCTAGGTGG + Intronic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
998355820 5:141535561-141535583 CTTGAAGTTCAAAATCTAGGTGG - Intronic
998656226 5:144182540-144182562 CTTGAAATCCAAAATACAGCAGG + Intronic
1003569458 6:7246712-7246734 CTTGAAGTCCATGAGCTTGGTGG - Exonic
1004050738 6:12076494-12076516 CTGGGATTCCAAGATCAAGGTGG + Intronic
1004736583 6:18412010-18412032 CTTAAAATCCATTATTTAGGAGG - Intronic
1004983994 6:21059409-21059431 CTTGAGACCCAAGATCCTGGTGG + Intronic
1005289481 6:24365104-24365126 CTTCAAATCCACGTGCTAGGTGG + Intergenic
1006960604 6:37926308-37926330 CTAGAAGTCCAAGATCTGGGAGG + Intronic
1007062645 6:38955833-38955855 ATTAAAATCCAAGACCTAGGAGG + Intronic
1008561355 6:52727962-52727984 CAGAAAATCTAAGATCTAGGGGG - Intergenic
1012834941 6:104252855-104252877 CTGGAAGTCCAATATCAAGGTGG - Intergenic
1013037950 6:106404917-106404939 CTTGAAACCCAAGGTCCTGGTGG - Intergenic
1013317760 6:108958209-108958231 CTGGAAGTCCAAGATCAGGGAGG - Intronic
1014403817 6:121023895-121023917 CTAGAATTCCAACATCAAGGTGG - Intergenic
1016801856 6:148176897-148176919 CTGGAAGTCTAAGATCTGGGTGG - Intergenic
1017602422 6:156098182-156098204 CTGGAAGTCCAAGATCAAGGTGG - Intergenic
1018426750 6:163690094-163690116 TTTGAAATCCAATATCTGGATGG - Intergenic
1022015383 7:26344892-26344914 CTGGAAGTCCAAAATCCAGGTGG + Intronic
1022615586 7:31926828-31926850 CTTGAAATCCAGGGTCCTGGTGG - Intronic
1023989541 7:45120039-45120061 CTGGAAGTCCAAGATCAAGGTGG + Intergenic
1024135982 7:46408876-46408898 CTTGAATTCCAAGATGTACTTGG - Intergenic
1026686225 7:72512453-72512475 CTGGAAATCCAAGATCAAGGGGG - Intergenic
1027309117 7:76935692-76935714 CTAGAAGTCCAAGATCAAGGTGG + Intergenic
1027404194 7:77842363-77842385 CTAAAAATACAAGATCTAGCTGG - Intronic
1028188092 7:87813015-87813037 CTACAAATCCACTATCTAGGAGG - Intronic
1029101134 7:98130790-98130812 CTCCAAGTCCAAGATCAAGGTGG - Intronic
1029623405 7:101704236-101704258 CTTAAAATCCAAAACCAAGGAGG + Intergenic
1030081465 7:105782370-105782392 CTTGAAATCCTAGATCTCGTGGG + Intronic
1030764138 7:113388131-113388153 CCTGAAATCGCAGTTCTAGGAGG - Intergenic
1030962341 7:115941695-115941717 CTAGAAATCCAGGATCAAGATGG - Intronic
1031824036 7:126540740-126540762 ATTGAATTCCAGGAGCTAGGGGG + Intronic
1033723906 7:144091946-144091968 CTTGGAAGACAAAATCTAGGTGG - Intergenic
1035123852 7:156592912-156592934 CTGGAAGTCCAAGACCAAGGTGG - Intergenic
1036126165 8:6064675-6064697 CTTGAACTACAAGATCCTGGAGG - Intergenic
1037308142 8:17527537-17527559 CTTGAAGTCCAAAATCAAGGTGG + Intronic
1037660810 8:20925191-20925213 CTGGAAGTTCAAGATCAAGGTGG + Intergenic
1038529267 8:28304451-28304473 CAGGAAGTCCAAGATCAAGGTGG + Intergenic
1039605924 8:38880690-38880712 CTGGAAGTCCAAGATCAGGGTGG + Intergenic
1039780042 8:40776015-40776037 CTAGAAGTCCATGATCAAGGTGG - Intronic
1041052951 8:53955522-53955544 CTTCAAATCTAAAATGTAGGAGG + Intronic
1041567041 8:59290457-59290479 CTAGAAGTCCAAGATTAAGGTGG + Intergenic
1042112187 8:65392377-65392399 CTTGAATGCTAAGTTCTAGGAGG + Intergenic
1042812949 8:72846051-72846073 CTTGAAACCCAGGACCTTGGTGG + Intronic
1043481344 8:80655904-80655926 CCTGCTATCCAAGTTCTAGGAGG - Intronic
1043609133 8:82040539-82040561 CTGAAAATGCAAGATCTGGGAGG - Intergenic
1044827127 8:96209271-96209293 CTGGAAATCCAAGATCAAGGTGG + Intergenic
1046177251 8:110593682-110593704 CTTGAAATCCAAGTTGTAGATGG - Intergenic
1046852340 8:118988611-118988633 CTAAAAATCCAAGATCTAATTGG + Intergenic
1047007397 8:120634651-120634673 TTTGAAACTCAGGATCTAGGTGG - Intronic
1047325350 8:123830611-123830633 CTAGAAGTCCACGATCAAGGTGG + Intergenic
1049617760 8:143583245-143583267 CTGGAAGTCCATGATCGAGGTGG - Intronic
1050043469 9:1519792-1519814 TTTGAACTCCAAGAACTATGAGG + Intergenic
1050837722 9:10104772-10104794 TTTAAAATCCAACATGTAGGTGG + Intronic
1051353870 9:16223410-16223432 CTTGAAATCCAGGGTCCTGGTGG - Intronic
1053111749 9:35466936-35466958 CCTGAAATCCAAGAGGTTGGTGG - Intergenic
1053645538 9:40117721-40117743 CTTGAAAATCAGGATCCAGGTGG - Intergenic
1053760176 9:41345806-41345828 CTTGAAAATCAGGATCCAGGTGG + Intergenic
1054326555 9:63715622-63715644 CTTGAAAATCAGGATCCAGGTGG - Intergenic
1054539035 9:66258251-66258273 CTTGAAAATCAGGATCCAGGTGG + Intergenic
1056178630 9:84060527-84060549 CTGGAAGTCCAAGATCAAAGTGG - Intergenic
1056578908 9:87876316-87876338 CTTCAAAGCCAGGATCTAAGGGG + Intergenic
1057053409 9:91942875-91942897 CTAGAAGTCCAAAATCAAGGTGG - Intronic
1057468066 9:95334237-95334259 CTTAAAATCCATGATCTATAAGG + Intergenic
1062115703 9:134806965-134806987 CTTGGAGACCAAGATCTGGGTGG - Intronic
1062353303 9:136149581-136149603 CTTTAAATCAAAGATGGAGGAGG + Intergenic
1186035931 X:5423621-5423643 CTGGAATTCCAAGATCAAGTCGG - Intergenic
1190079900 X:47348040-47348062 TGGGAAATCCAAGATCAAGGAGG + Intergenic
1191974482 X:66856653-66856675 CTTGAAAACAAAGACATAGGTGG - Intergenic
1192030664 X:67509224-67509246 CTTGAAACCCAAGGCCTTGGTGG - Intergenic
1192612326 X:72579421-72579443 TTAGAAATCCAAGATAAAGGAGG + Exonic
1192953218 X:76039720-76039742 CTTGAAACCCAGGACCTTGGTGG + Intergenic
1193696253 X:84710137-84710159 CTTGAAATCCAAAAGGGAGGAGG + Intergenic
1197834228 X:130677731-130677753 CTGGAAGTCTAAGGTCTAGGGGG - Intronic
1198264840 X:134999421-134999443 CTAGAAGTCCAAGATCAAGGTGG + Intergenic
1201335038 Y:12871599-12871621 TGGGAAATCCAAGATCAAGGTGG - Intergenic
1201611836 Y:15851713-15851735 CTTGAAATCCAGGATCCTTGTGG - Intergenic