ID: 1093561827

View in Genome Browser
Species Human (GRCh38)
Location 12:20551868-20551890
Sequence TGGGTCCGTAGTGGTTGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093561827_1093561834 -5 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561834 12:20551886-20551908 ACCCATCCCGGGGATCCCCGTGG 0: 2
1: 0
2: 0
3: 4
4: 121
1093561827_1093561840 6 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561827_1093561841 9 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561841 12:20551900-20551922 TCCCCGTGGGCACCATGTGGCGG 0: 2
1: 0
2: 2
3: 7
4: 145
1093561827_1093561836 -4 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561836 12:20551887-20551909 CCCATCCCGGGGATCCCCGTGGG 0: 2
1: 0
2: 0
3: 4
4: 98
1093561827_1093561846 22 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093561827 Original CRISPR TGGGTCCGTAGTGGTTGGAC GGG (reversed) Intronic