ID: 1093561840

View in Genome Browser
Species Human (GRCh38)
Location 12:20551897-20551919
Sequence GGATCCCCGTGGGCACCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093561827_1093561840 6 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561833_1093561840 -3 Left 1093561833 12:20551877-20551899 CCACTACGGACCCATCCCGGGGA 0: 2
1: 0
2: 0
3: 0
4: 44
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561825_1093561840 13 Left 1093561825 12:20551861-20551883 CCATCATCCCGTCCAACCACTAC 0: 1
1: 1
2: 0
3: 9
4: 142
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561823_1093561840 30 Left 1093561823 12:20551844-20551866 CCGCACCAAGGAATGTACCATCA 0: 1
1: 1
2: 0
3: 7
4: 134
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561829_1093561840 1 Left 1093561829 12:20551873-20551895 CCAACCACTACGGACCCATCCCG 0: 2
1: 0
2: 0
3: 2
4: 31
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561824_1093561840 25 Left 1093561824 12:20551849-20551871 CCAAGGAATGTACCATCATCCCG 0: 1
1: 1
2: 0
3: 2
4: 78
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117
1093561828_1093561840 5 Left 1093561828 12:20551869-20551891 CCGTCCAACCACTACGGACCCAT 0: 2
1: 0
2: 0
3: 6
4: 94
Right 1093561840 12:20551897-20551919 GGATCCCCGTGGGCACCATGTGG 0: 2
1: 0
2: 1
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093561840 Original CRISPR GGATCCCCGTGGGCACCATG TGG Intronic