ID: 1093561846

View in Genome Browser
Species Human (GRCh38)
Location 12:20551913-20551935
Sequence CATGTGGCGGTTCCGAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093561833_1093561846 13 Left 1093561833 12:20551877-20551899 CCACTACGGACCCATCCCGGGGA 0: 2
1: 0
2: 0
3: 0
4: 44
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561837_1093561846 2 Left 1093561837 12:20551888-20551910 CCATCCCGGGGATCCCCGTGGGC 0: 2
1: 0
2: 0
3: 16
4: 126
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561839_1093561846 -3 Left 1093561839 12:20551893-20551915 CCGGGGATCCCCGTGGGCACCAT 0: 2
1: 0
2: 0
3: 8
4: 102
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561827_1093561846 22 Left 1093561827 12:20551868-20551890 CCCGTCCAACCACTACGGACCCA 0: 2
1: 0
2: 0
3: 3
4: 63
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561835_1093561846 3 Left 1093561835 12:20551887-20551909 CCCATCCCGGGGATCCCCGTGGG 0: 2
1: 0
2: 0
3: 4
4: 87
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561825_1093561846 29 Left 1093561825 12:20551861-20551883 CCATCATCCCGTCCAACCACTAC 0: 1
1: 1
2: 0
3: 9
4: 142
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561829_1093561846 17 Left 1093561829 12:20551873-20551895 CCAACCACTACGGACCCATCCCG 0: 2
1: 0
2: 0
3: 2
4: 31
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561828_1093561846 21 Left 1093561828 12:20551869-20551891 CCGTCCAACCACTACGGACCCAT 0: 2
1: 0
2: 0
3: 6
4: 94
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55
1093561838_1093561846 -2 Left 1093561838 12:20551892-20551914 CCCGGGGATCCCCGTGGGCACCA 0: 2
1: 0
2: 2
3: 9
4: 136
Right 1093561846 12:20551913-20551935 CATGTGGCGGTTCCGAGTCCAGG 0: 2
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093561846 Original CRISPR CATGTGGCGGTTCCGAGTCC AGG Intronic