ID: 1093562136

View in Genome Browser
Species Human (GRCh38)
Location 12:20553637-20553659
Sequence AGTCCTCTGCCCACGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093562132_1093562136 14 Left 1093562132 12:20553600-20553622 CCCACCAGACTGCTTAGCGTCTG 0: 2
1: 0
2: 0
3: 6
4: 53
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562131_1093562136 15 Left 1093562131 12:20553599-20553621 CCCCACCAGACTGCTTAGCGTCT 0: 2
1: 0
2: 1
3: 9
4: 70
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562129_1093562136 20 Left 1093562129 12:20553594-20553616 CCATCCCCCACCAGACTGCTTAG 0: 2
1: 0
2: 0
3: 16
4: 240
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562133_1093562136 13 Left 1093562133 12:20553601-20553623 CCACCAGACTGCTTAGCGTCTGA 0: 2
1: 0
2: 0
3: 4
4: 66
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562134_1093562136 10 Left 1093562134 12:20553604-20553626 CCAGACTGCTTAGCGTCTGAGAT 0: 2
1: 1
2: 2
3: 9
4: 164
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562128_1093562136 28 Left 1093562128 12:20553586-20553608 CCTCAAAGCCATCCCCCACCAGA 0: 2
1: 0
2: 1
3: 47
4: 354
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125
1093562130_1093562136 16 Left 1093562130 12:20553598-20553620 CCCCCACCAGACTGCTTAGCGTC 0: 2
1: 0
2: 0
3: 8
4: 100
Right 1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG 0: 2
1: 0
2: 1
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093562136 Original CRISPR AGTCCTCTGCCCACGAGAGC AGG Intronic
900495157 1:2972851-2972873 CGTCCCCTCCCCTCGAGAGCGGG + Intergenic
900777518 1:4595907-4595929 AGGCCTCTGCCCAGAGGAGCCGG + Intergenic
901361563 1:8705382-8705404 AGGCTTCTTCCCACCAGAGCAGG + Intronic
901684479 1:10936017-10936039 AGGCCTCTGCACAGTAGAGCGGG - Intergenic
903350328 1:22712921-22712943 AGGCCTCTTCCAACGAGAGAGGG - Intronic
905479198 1:38249616-38249638 AGTCCTCTGCACACATGACCTGG - Intergenic
905683993 1:39895956-39895978 AGAACTCTGCCCAGGACAGCAGG - Exonic
905784566 1:40743988-40744010 AGTACTCTACCCACTAGAGCAGG + Intronic
911859874 1:102933549-102933571 AGTGCTCTGCCCCCCAGAGGTGG + Intronic
916851256 1:168706539-168706561 AGGCTTCTTCCCACAAGAGCTGG + Intronic
918218059 1:182410308-182410330 ACTCCTCTTCCCACCAGAGAGGG + Intergenic
919484536 1:198130352-198130374 GGACCTCTGCCCAGGAAAGCTGG - Intergenic
922620137 1:226983936-226983958 AGCCCTCTGCCCCTCAGAGCTGG - Intronic
922792493 1:228317919-228317941 AGCCCTCAGCCCCTGAGAGCCGG + Exonic
1065020410 10:21497319-21497341 AGTCCCCACCCCCCGAGAGCTGG + Intergenic
1065898064 10:30182008-30182030 TCTCCACTGCCCAGGAGAGCTGG + Intergenic
1066633505 10:37479442-37479464 TGTCCTCTGCCCATTAGAACAGG + Intergenic
1067723453 10:48748166-48748188 ACTCCCCTGCCCCTGAGAGCTGG - Intronic
1074078284 10:110149206-110149228 ACTCCTCTTCCCACTACAGCTGG + Intergenic
1076319258 10:129566105-129566127 AGTCCCCAGCCCTGGAGAGCTGG - Intronic
1076377957 10:130004057-130004079 AGACCTCTGCTCCCTAGAGCTGG + Intergenic
1076623716 10:131809092-131809114 ATTCCAGTGCCCACGAGATCGGG + Intergenic
1081770269 11:45646002-45646024 AGTGTTCTGCCCACGAGGGCAGG - Intergenic
1082969528 11:59005035-59005057 GGACCTCTGCCCAGGAAAGCCGG + Intronic
1083720494 11:64601369-64601391 AGTTCTGGGCCCCCGAGAGCAGG + Intronic
1083769295 11:64857474-64857496 AGCCCTCTGTCCTCCAGAGCCGG + Intronic
1084088339 11:66864917-66864939 AGGCCTCTGCCCCCGAGAAGCGG - Intronic
1084517371 11:69644129-69644151 GGGCCTCTGCTCACCAGAGCTGG - Intronic
1090626996 11:128616399-128616421 AGGCCTCTGTCCCCAAGAGCTGG - Intergenic
1093562136 12:20553637-20553659 AGTCCTCTGCCCACGAGAGCAGG + Intronic
1094175642 12:27538100-27538122 AGTCCTCTGCACAGAAGAGCAGG - Intronic
1094874862 12:34628958-34628980 GGACCTCTGCCCAGGAAAGCCGG - Intergenic
1095890163 12:47228430-47228452 TCTCCTCTGCCCAGGAGAGATGG - Intronic
1100405518 12:94269513-94269535 AGTGCTCTGCCTACCAGTGCTGG + Intronic
1102581949 12:113894945-113894967 TGTCCTCTGGCCAGAAGAGCAGG - Intronic
1104356124 12:128088637-128088659 AGTCCTCTGCCCTGGGGAGTGGG + Intergenic
1105055096 12:133091202-133091224 AGACCTCTGCCCTTGAAAGCAGG - Intronic
1113589511 13:111488689-111488711 CTTCCTCTGCACACGAGGGCAGG + Intergenic
1113921389 13:113914947-113914969 TGTCCTCTGCCCCCGAGTGGAGG - Intergenic
1119405393 14:74395505-74395527 AGCCCTCTGCCCAACACAGCTGG - Intergenic
1121673240 14:95729777-95729799 GGACCTCTGCCCAGGAAAGCCGG - Intergenic
1122361460 14:101169310-101169332 AGTGCTCTGCTTTCGAGAGCGGG - Intergenic
1122418456 14:101561254-101561276 AGTCCCCCGCCCCCGAGAGCTGG + Intergenic
1126002919 15:44228918-44228940 AGACCTCTGCCCTTGAAAGCGGG + Intergenic
1126473783 15:49045978-49046000 AGCCCTCCTCCCAGGAGAGCAGG + Intronic
1126668599 15:51095417-51095439 AGTCTTCTGCCAGCGAGGGCAGG + Intronic
1128221958 15:65975566-65975588 AGTGCTCTTCCCACCAGACCAGG - Intronic
1138315170 16:56063763-56063785 AGCCCTCTGCACAAGAGAACTGG - Intergenic
1141094387 16:81152637-81152659 AGTCCTCAGCCCAAGATAGACGG - Intergenic
1141691311 16:85598324-85598346 GGTGGGCTGCCCACGAGAGCCGG + Intergenic
1142522794 17:517004-517026 TGTCCTCAACCCAGGAGAGCTGG - Exonic
1144932883 17:18874521-18874543 ACTCCTCTTCCCAGGAGAGATGG - Intronic
1150894497 17:69195679-69195701 GGTCCTCTGCCTAGGAAAGCCGG - Intronic
1151971860 17:77461522-77461544 ACTCCTCTGCAAACAAGAGCAGG - Intronic
1152335083 17:79696133-79696155 AGCCCTCTTCCCTGGAGAGCCGG + Intergenic
1152770595 17:82165860-82165882 AAACCTCAGCCCACCAGAGCGGG + Intronic
1153012459 18:551481-551503 AGTCCTCAGCCCAAGACACCTGG - Intergenic
1156501737 18:37564619-37564641 AGTCCCCTTCCCAGGAAAGCGGG - Intronic
1161559136 19:4961427-4961449 AGTCCTCTGCCCACGAGAGCAGG + Exonic
1162278586 19:9677436-9677458 GGACCTCTGCCCAGGAAAGCTGG - Intergenic
1163939683 19:20480243-20480265 ACCCCTCTGCCCTGGAGAGCAGG - Intergenic
1164593673 19:29519925-29519947 ATTCCTGTGCCCAGAAGAGCGGG - Intergenic
1165932515 19:39369150-39369172 AGTCATGTGCCCACCACAGCTGG - Intronic
925969094 2:9094544-9094566 AGTTCTGTGCACACCAGAGCAGG - Intergenic
928168510 2:28988311-28988333 AGTCTGCTGCACATGAGAGCTGG - Intronic
928373539 2:30757969-30757991 AGCCTCCTGCCCATGAGAGCAGG - Intronic
931652043 2:64477411-64477433 AGTCCTCTGCACAAGTCAGCAGG + Intergenic
931665329 2:64606411-64606433 AGCCCTCAGCCCAGGAGAGGTGG + Intergenic
934781044 2:96969919-96969941 AGTCCTCCCACCAGGAGAGCTGG + Intronic
944423724 2:199557690-199557712 ACTCCACTGCCCCCGGGAGCGGG + Intergenic
947395614 2:229683934-229683956 AGTGCTCTGCACAGGAGAGGAGG - Intronic
948365004 2:237449127-237449149 ATTTCTCTGCCCACCACAGCAGG + Intergenic
948506839 2:238434124-238434146 AGTCATCTGCCCCCGGGACCTGG + Intronic
948515373 2:238500123-238500145 AGTCCTCGCCCCAGGGGAGCCGG - Intergenic
948696656 2:239736307-239736329 AGCCCGCTGCCCACCAGGGCTGG - Intergenic
949052625 2:241905270-241905292 CGTCCTCTGCCCAGGAGAAAAGG + Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1176091288 20:63319678-63319700 ACTCCTCTCCCTAGGAGAGCAGG + Intronic
1181516204 22:23415120-23415142 AGTCCTCTGACCCCGTGAGGTGG + Intergenic
1182679636 22:32068604-32068626 AGTCCACTGCCCCAGAGGGCTGG + Intronic
1184723792 22:46331522-46331544 AGTCCTCTGCCGTCGAGAGCAGG + Intronic
952233195 3:31453359-31453381 AGTCCTCTTCCGAGGATAGCCGG + Intergenic
954423544 3:50431394-50431416 AGTTCACTGCCCAGGAGCGCTGG + Intronic
958044564 3:88267787-88267809 AATCCTCAGCCAACAAGAGCAGG - Intergenic
962410069 3:135133153-135133175 AGGCCTCTGCCCAGGAGTGAAGG + Intronic
969000629 4:3977994-3978016 GGACCTCTGCCCTTGAGAGCAGG - Intergenic
969813289 4:9666862-9666884 GGACCTCTGCCCTTGAGAGCAGG + Intergenic
974621119 4:64356183-64356205 AGACCTCTGCCCTGGAAAGCCGG + Intronic
978761682 4:112359871-112359893 AGTTCTTGGCCCACCAGAGCTGG - Intronic
983359145 4:166706187-166706209 AGTCTTTTGTCCACTAGAGCTGG - Intergenic
983679939 4:170341919-170341941 TGTCCTTTGCCCACTAGAGTAGG + Intergenic
985573813 5:664569-664591 TGCCCTCTGCCCAGGAAAGCAGG + Exonic
985734183 5:1568022-1568044 GGACCTCTGCCCAGGAAAGCCGG - Intergenic
986529461 5:8720705-8720727 AGTCCTCTCCCCACGTTTGCAGG - Intergenic
988431149 5:31120080-31120102 AATCGTCTGCCCACAACAGCAGG + Intergenic
989576788 5:42995412-42995434 TGCCCTCTGCCCACGAGCTCCGG + Intergenic
994274771 5:97822489-97822511 ACTCCTCTAGCCACCAGAGCTGG + Intergenic
994758318 5:103821635-103821657 AGTTCTCTTGCCATGAGAGCTGG + Intergenic
998001659 5:138630658-138630680 AGCCCCCTGCCCCAGAGAGCTGG + Intronic
999383045 5:151135103-151135125 AGACCTCTGCCCACGTAAGAAGG - Intronic
1001531220 5:172463221-172463243 AGGCCCATGCCCAGGAGAGCTGG - Intergenic
1001962175 5:175886191-175886213 AGTCCCCTGCCCAAGAGTGTGGG - Intergenic
1002047087 5:176548270-176548292 TGTCCTCTGCCCACAAGAAGAGG + Intronic
1006150311 6:31983501-31983523 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1006156612 6:32016239-32016261 AGTCCTCTTCCCAGGGAAGCAGG + Intronic
1010163677 6:72890049-72890071 TGCCCTCTGCCCAGGAGGGCAGG + Intronic
1015289267 6:131520069-131520091 AGTTCTCTGCCCAGGAAAGGAGG + Intergenic
1015394798 6:132721446-132721468 GGACCTCTGCCCAGGAAAGCCGG - Intergenic
1018384573 6:163291126-163291148 ACCCCTCTGCCCGCCAGAGCTGG + Intronic
1018384608 6:163291263-163291285 ACCCCTCTGCCCGCCAGAGCTGG + Intronic
1018384631 6:163291354-163291376 ACCCCTCTGCCCGCCAGAGCTGG + Intronic
1018612111 6:165656441-165656463 AGTCCTCGGCACACGAGAAGAGG - Intronic
1019638735 7:2090901-2090923 AGTTCTCTGCCCTCAAGAGATGG - Intronic
1032855608 7:135831029-135831051 AGTTCTCTGCCCACAAGATGGGG + Intergenic
1034436901 7:151066786-151066808 ACTCCTTTGCCCACCAGTGCCGG - Intronic
1034942010 7:155236752-155236774 AGGCCTCTGCCCACTTCAGCTGG + Intergenic
1035470814 7:159107550-159107572 AGTCCTCTTCCCACCCGGGCTGG - Intronic
1035948182 8:3988592-3988614 AGTCCTGTGCACATGACAGCTGG + Intronic
1046740195 8:117819667-117819689 AGTACTGTGCCCAGGTGAGCGGG - Exonic
1048295563 8:133211152-133211174 ACTGCTCTGCCCAGGAGAGTGGG - Intronic
1057045415 9:91882445-91882467 AATCCACTCCCCATGAGAGCTGG + Intronic
1057855862 9:98600272-98600294 AGTGCTCTGCCCAGCAGAGAAGG - Intronic
1059053309 9:110952565-110952587 ACTCTGCTGCCCACGATAGCAGG + Intronic
1062134386 9:134917163-134917185 AGTCCTCCTTCCACTAGAGCAGG + Intronic
1062507444 9:136885418-136885440 TGTCATCTGCCCAGGAGAACGGG - Intronic
1062548856 9:137077050-137077072 ATTCCTCTGCCCACGCCAGCTGG + Intergenic
1187403114 X:18980186-18980208 GGACCTCTGCCCAGGAAAGCCGG + Intronic
1190479650 X:50863272-50863294 AGTCCTTTTCCCCAGAGAGCTGG - Intergenic
1195755930 X:108198728-108198750 AGTCCAGAGCCCAGGAGAGCAGG - Intronic
1196096977 X:111810257-111810279 AGTCCTCTCCCCATGAGTGTGGG - Intronic
1200234457 X:154461568-154461590 AGTGCCCTCCCCACGATAGCAGG - Exonic
1201068742 Y:10125034-10125056 AGACCTCTGCCTAGGAAAGCCGG - Intergenic
1201611853 Y:15851873-15851895 AGTCCCCTTTCCAGGAGAGCAGG - Intergenic