ID: 1093565901

View in Genome Browser
Species Human (GRCh38)
Location 12:20603279-20603301
Sequence TTCTATTTAGTCATCCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093565901_1093565904 1 Left 1093565901 12:20603279-20603301 CCTCCCAGGATGACTAAATAGAA 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1093565904 12:20603303-20603325 GAAAAAAATACTTCCAACAATGG 0: 1
1: 0
2: 5
3: 67
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093565901 Original CRISPR TTCTATTTAGTCATCCTGGG AGG (reversed) Intronic
910384198 1:86664129-86664151 TTCAATTTGGTCTTCCTGTGAGG - Intergenic
910384458 1:86665791-86665813 TTCAATTTGGTCTTCCTGTGAGG + Intergenic
911052592 1:93683308-93683330 TTAATTTTAGTCATTCTGGGTGG - Intronic
912073744 1:105846667-105846689 GTTTATTTGGTAATCCTGGGGGG - Intergenic
914722845 1:150303617-150303639 TTCCATTTTGTGATCTTGGGCGG + Intronic
916397004 1:164401794-164401816 TTAAATTTAGTCATCCTAGTAGG - Intergenic
916440567 1:164820643-164820665 ATGTATTTAGTCAACCTGGCTGG - Intronic
917528966 1:175815788-175815810 TTCCATTTGATCACCCTGGGAGG - Intergenic
919753028 1:201050016-201050038 TTAGATTCAGTCAGCCTGGGAGG + Intronic
919925624 1:202190448-202190470 TGACATTTAGTCCTCCTGGGAGG - Intergenic
920975415 1:210781144-210781166 TTATATTTTGTAATCCTTGGAGG + Intronic
921464144 1:215465105-215465127 TTCTAGTTATTCATCATGGTGGG - Intergenic
921878518 1:220226932-220226954 TTCTATGTACACATGCTGGGAGG - Intronic
921917304 1:220627044-220627066 TTCTGGTTAGTCATACTGGAAGG - Intronic
1063906766 10:10788286-10788308 TTCTATTTAGTCACCCTTTTAGG - Intergenic
1065172698 10:23047932-23047954 TTCTTTTGAGTTATCTTGGGAGG + Intergenic
1067770416 10:49118767-49118789 TTCTATCTAGACATCCTGTCAGG - Intergenic
1068194377 10:53697037-53697059 TTCTATATAGTCTTCCTTTGAGG + Intergenic
1068449146 10:57164298-57164320 TTCTATTCAGCCATCTTGGCTGG - Intergenic
1069753015 10:70756957-70756979 TTGTAATGATTCATCCTGGGAGG + Intronic
1070461975 10:76679231-76679253 TGGTAATTACTCATCCTGGGAGG - Intergenic
1072989838 10:100181889-100181911 TCCTATTTAGTCACACTGGCTGG + Intronic
1075962184 10:126578445-126578467 TTCTTTTTAGCCATCCTGATGGG - Intronic
1077897194 11:6462141-6462163 TTCTATATAGTCATCAAGGAAGG - Intronic
1079962625 11:26942874-26942896 TTCTATTTAGACTTCCTTGTTGG - Intergenic
1081040410 11:38203190-38203212 TTTTCTTTTGTCATCCTTGGTGG - Intergenic
1081040571 11:38205345-38205367 TTTTCTTTTGTCATCCTTGGTGG - Intergenic
1081251565 11:40841795-40841817 TTCTATTTAGCAATCTTGGTTGG - Intronic
1086221336 11:84447446-84447468 TTCTGTTTAATCATCCTGTGAGG + Intronic
1088019308 11:105100324-105100346 TTCTGTTTACTCATCCTCAGTGG - Intronic
1091169606 11:133508418-133508440 TTCTATGTAATGATCCAGGGTGG + Intronic
1093565901 12:20603279-20603301 TTCTATTTAGTCATCCTGGGAGG - Intronic
1094471989 12:30811296-30811318 TTATTTTTAGTCATTCTGGTAGG - Intergenic
1098220198 12:68261999-68262021 TTCATTTTAGTCATTCTGGTGGG - Intergenic
1099081534 12:78189170-78189192 TTCTATTCCCTCTTCCTGGGGGG - Intronic
1100690934 12:97037855-97037877 TTCTGTTGAGTCATTCAGGGAGG + Intergenic
1103347574 12:120261620-120261642 TCCTATTTAGTCATCCTGCTTGG - Intronic
1104753924 12:131257206-131257228 TTCCACTTAGTGTTCCTGGGTGG + Intergenic
1107147640 13:37075873-37075895 TTCTATTTAGTCTCCCTTGCTGG + Intergenic
1107409151 13:40142362-40142384 TTCTAGTTAGTCATCCTTTGCGG + Intergenic
1107813545 13:44222780-44222802 TTCTTTTTAGCCATTCTGGTGGG + Intergenic
1108574515 13:51779764-51779786 TTTTCTTTAGTCTTCCTGTGTGG + Intronic
1111537810 13:89626837-89626859 TTCTGTTTAGTCATCCCATGTGG + Intergenic
1111644492 13:91014127-91014149 ATCTATTTAGAAATCCTTGGAGG + Intergenic
1115770597 14:36661687-36661709 TTGTATTTAGTCACCCAGGTGGG + Intronic
1118444043 14:65835874-65835896 TTTGATTTAGTTAACCTGGGAGG - Intergenic
1118657957 14:67973641-67973663 GTTATTTTAGTCATCCTGGGTGG + Intronic
1124941045 15:34218392-34218414 TTCTATTTTGTCATCCTTCCTGG - Intergenic
1125214968 15:37261727-37261749 TTCCATGTAGCCATCCTGTGAGG + Intergenic
1126566932 15:50111077-50111099 TGCTATTTAAGCATCCTGTGAGG + Intronic
1129091021 15:73151127-73151149 TTAACTTTAGTCATCCTGGTAGG + Intronic
1129370662 15:75091994-75092016 TTCACTTTAGTCATTCTGGTAGG - Intronic
1131332726 15:91516611-91516633 TTCTTTTTTGTAATCATGGGTGG + Intergenic
1132169610 15:99636075-99636097 TTCATTTTAGTCATTCTGGTAGG + Intronic
1132775459 16:1591245-1591267 TTCTCATTAGCCTTCCTGGGGGG + Intronic
1133421792 16:5652765-5652787 TTCTGGTTAGTGACCCTGGGTGG + Intergenic
1138721849 16:59091338-59091360 TCCTATTTAGTAATTCAGGGTGG - Intergenic
1142319451 16:89371678-89371700 ATCCATCTAGTCATCCTGAGGGG - Intronic
1150550210 17:66203246-66203268 TTCTATTTGGTGTTCCTGTGAGG - Intergenic
1151517496 17:74605843-74605865 ATCTATTTGGTTCTCCTGGGAGG - Intergenic
1154346434 18:13547152-13547174 TTCCATTAAGTCATCCTTTGAGG + Intronic
1155718082 18:28971577-28971599 TTCCATTCAGTAATCTTGGGTGG - Intergenic
1155783564 18:29871968-29871990 TTCCATTTAGTAAACCTAGGTGG + Intergenic
1157138114 18:45077557-45077579 TTCTAGTTGGTCATCTTTGGAGG - Intergenic
1157734014 18:50030570-50030592 TTCTAGTTAGTGGTCCTGGTTGG - Intronic
1159255236 18:65936615-65936637 TTCTTTTTAGTCATTCTTGTGGG - Intergenic
1159505654 18:69331991-69332013 TTCATGTTAGCCATCCTGGGGGG + Intergenic
1161753606 19:6115224-6115246 TTGTATTTAGCCAGCCTTGGTGG - Intronic
1162883393 19:13677577-13677599 TTCTTTTTATTTATCCTGGTTGG - Intergenic
1164995532 19:32718454-32718476 TGCTATTTACTCTTCCTGGTTGG + Intergenic
1165886202 19:39080590-39080612 TTATTTTTAGTCATTCTGGTGGG - Intergenic
924964556 2:63414-63436 ATTTTTTTACTCATCCTGGGAGG - Intergenic
925258392 2:2508910-2508932 TTCAATTTATTCATTCTGGGTGG - Intergenic
927267298 2:21164131-21164153 TTCTCTTTTGTCTTCCTGGAAGG - Intergenic
928764547 2:34627961-34627983 TTCTTTTTTGAGATCCTGGGGGG - Intergenic
929446619 2:42006993-42007015 TTCATTTTAGTCATTCTGGTGGG - Intergenic
931423422 2:62149249-62149271 TTCTATGGAGTCTTCCTGTGAGG + Intergenic
937595906 2:123673138-123673160 TTATATTTAATCAGCATGGGAGG + Intergenic
938834495 2:135086392-135086414 TTATATTTAGTCATTCTGTTGGG + Intronic
939732407 2:145800721-145800743 TTGTATTTATTCACCATGGGAGG - Intergenic
939815208 2:146887072-146887094 TTCTTTTTAATCATCCAGGCTGG - Intergenic
940822000 2:158366366-158366388 TTTTATTTTGTGTTCCTGGGAGG + Intronic
943337406 2:186634119-186634141 TATTATTCAGTCATTCTGGGAGG + Intronic
1171353504 20:24524099-24524121 TTGTTTTTACTCATCCTTGGAGG + Intronic
1171563488 20:26153475-26153497 TTCTATTTACTCATTCTTGCTGG + Intergenic
1171754290 20:29087479-29087501 TTCTCGTTGGTCATCGTGGGAGG + Intergenic
1172534993 20:35665876-35665898 TTCGCTTTTGTCATCCAGGGTGG - Intronic
1174137473 20:48390578-48390600 TTCTATTCAGTCATCCTCAGTGG - Intergenic
1178584993 21:33864263-33864285 TCCTAGTTAGTGATCATGGGTGG - Intronic
1180412244 22:12624772-12624794 TTCTATTAAGGCATGCTGGCTGG - Intergenic
1181028436 22:20138624-20138646 TTCTACTTTGTCATCTGGGGAGG + Intronic
1182812130 22:33125775-33125797 TTTTATTTAGTCACCCAGGCTGG + Intergenic
950943384 3:16917677-16917699 TTTTATCTAGTTCTCCTGGGAGG - Intronic
952757315 3:36882257-36882279 TTTATTTTAGTCATCCTGGTGGG + Intronic
957800676 3:85076163-85076185 TTCTCTTTAGTTATGCAGGGAGG - Intronic
958553496 3:95645052-95645074 TCCTATTTAGCCATCTTGGAAGG - Intergenic
960256127 3:115513138-115513160 TTCTATTTAGTTATGCTGCAGGG - Intergenic
962930882 3:140034842-140034864 TGCTTTTTAGTCACCCTGTGAGG - Intronic
966273557 3:178137895-178137917 ATCTATTTAGCCTCCCTGGGAGG - Intergenic
969255761 4:6000647-6000669 ATCTGTTTTGTCATCCTGTGGGG + Intergenic
970531081 4:16984991-16985013 TTCTATTTAAAAATCCTGGTGGG - Intergenic
970864038 4:20738622-20738644 TCCTATGTAGCCATCTTGGGGGG - Intronic
971988002 4:33851500-33851522 TTCTATTTATTCATTCTTGCTGG - Intergenic
973155093 4:46941725-46941747 TTTTATTTAGTTTTCCTAGGTGG + Intronic
979417350 4:120460342-120460364 TCCTATTTAGCCATCTTGGCTGG - Intergenic
980063701 4:128158717-128158739 TTTAATGTAGTCATCCTGGTAGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
986860586 5:11922317-11922339 GTCTATTTATTCATCCTGATAGG - Intergenic
989299949 5:39878980-39879002 TTCTATTTAGCCATCATGTTTGG + Intergenic
990002890 5:50915184-50915206 TTTTATTTAGTCATTCTAGTGGG - Intergenic
994218009 5:97160173-97160195 TTCTATTTGGTCATCTTGTTCGG + Intronic
995249024 5:109968136-109968158 TTCTTTTTTGTCATCCTGGAGGG + Intergenic
996446330 5:123556264-123556286 TTCTTTTTAGTTATCCTGTTTGG + Intronic
998563774 5:143197412-143197434 AGCTATTTAGTCATTCTGGTGGG + Intronic
998637208 5:143968998-143969020 TTCTTTTTAGTCATCTTGGAAGG + Intergenic
999259403 5:150228681-150228703 TTCTAATTTGTCTTCCTGTGGGG + Intronic
1000867638 5:166534808-166534830 TTCATTTTAGCCATCCTGGTGGG + Intergenic
1001785953 5:174413396-174413418 TTCTATTTACTCTTAGTGGGAGG - Intergenic
1003864670 6:10351959-10351981 TTCTGGACAGTCATCCTGGGCGG - Intergenic
1003982143 6:11399934-11399956 TTCCATTTAGTTTTCCAGGGTGG - Intergenic
1006024754 6:31139691-31139713 TTTTCTGCAGTCATCCTGGGTGG - Exonic
1006394630 6:33779081-33779103 TTCAATATGGTCATCCTGAGCGG + Intronic
1006551884 6:34830867-34830889 TTCATTTTAATCATCCTGGTGGG + Intronic
1007979396 6:46135346-46135368 TTTTATTTACTCATCCTTCGGGG + Intronic
1008443326 6:51558097-51558119 TTTTATTTAATCATTCTGAGAGG - Intergenic
1008664413 6:53701934-53701956 TTCTATTTATTCTGCCTGGCAGG - Intergenic
1010050623 6:71499903-71499925 GTCTAAGTAGTCATCTTGGGAGG - Intergenic
1010062609 6:71641713-71641735 TTCTATTTAGTCATTATTTGAGG - Intergenic
1019655275 7:2190764-2190786 TTCACTTTAGCCATCCTGGTGGG - Intronic
1019762610 7:2824855-2824877 TTCTATTCAGTAGGCCTGGGAGG - Intronic
1021418896 7:20422431-20422453 TTCCCTTTAGTTTTCCTGGGAGG - Intergenic
1022024828 7:26437835-26437857 TTGGATTTAATCATCCAGGGTGG - Intergenic
1022236079 7:28461518-28461540 TTCTATTAATTCATCATGAGTGG + Intronic
1024984377 7:55182629-55182651 TGCTATCTGGTTATCCTGGGAGG - Intronic
1025274229 7:57560820-57560842 TTCTATTTACTCATTCTTGCTGG - Intergenic
1031900646 7:127406545-127406567 TTCCATATAGTCATCCTTGCTGG + Intronic
1041743732 8:61183785-61183807 TTCTACTTACTCATTCGGGGTGG - Intronic
1043220206 8:77653038-77653060 TTATATGTAGTCGTCTTGGGTGG - Intergenic
1045513636 8:102836707-102836729 TTCAATTTAGTCTTCCTAGGTGG - Intronic
1046403017 8:113731825-113731847 TTCTCTATAGTTATCTTGGGGGG - Intergenic
1048311647 8:133327175-133327197 TTCTTTTTAGTCATCTTTTGAGG - Intergenic
1053278552 9:36801467-36801489 TTCTCTTTGCTCTTCCTGGGTGG - Intergenic
1055636700 9:78286334-78286356 TTCTAAGTAGTCTTCCTGTGTGG + Intergenic
1059636430 9:116175687-116175709 TTCTATATAGTGATACAGGGTGG + Intronic
1059874279 9:118616754-118616776 TTCTATTTAGGTAACCTGGGGGG + Intergenic
1060126575 9:121053504-121053526 TTCTATTTGGTGTTCCTGTGTGG - Intergenic
1187056933 X:15749551-15749573 TTGTTTTTAGTCAGCCTGGAGGG + Intronic
1190959876 X:55235271-55235293 TCCTATTTAGTCATCTTGCCTGG + Intronic
1191269891 X:58451676-58451698 TTCTGTTTAGTTTTCCTGTGAGG - Intergenic
1196264537 X:113626680-113626702 CTCAATTTGGTCATCCTGAGGGG + Intergenic
1201965825 Y:19734015-19734037 TTCATTTTAGCCATTCTGGGAGG - Intronic