ID: 1093566206

View in Genome Browser
Species Human (GRCh38)
Location 12:20607068-20607090
Sequence CAGGATGTCCTACCTAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093566206_1093566211 -3 Left 1093566206 12:20607068-20607090 CCAGGATTAGGTAGGACATCCTG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1093566211 12:20607088-20607110 CTGGAAATGGGAAAGTAGACTGG 0: 1
1: 0
2: 3
3: 28
4: 314
1093566206_1093566212 13 Left 1093566206 12:20607068-20607090 CCAGGATTAGGTAGGACATCCTG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1093566212 12:20607104-20607126 AGACTGGATGAAGATAAAAGAGG 0: 1
1: 0
2: 1
3: 61
4: 437
1093566206_1093566213 19 Left 1093566206 12:20607068-20607090 CCAGGATTAGGTAGGACATCCTG 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1093566213 12:20607110-20607132 GATGAAGATAAAAGAGGAAAAGG 0: 1
1: 0
2: 15
3: 101
4: 1206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093566206 Original CRISPR CAGGATGTCCTACCTAATCC TGG (reversed) Intronic
908487337 1:64607651-64607673 CAGTATCTCTTACCTAATCAGGG - Intronic
908695671 1:66838521-66838543 CAGCATGAGCTACCTAATACAGG + Intronic
909931392 1:81503405-81503427 CACCAAGTCCTACCTCATCCCGG + Intronic
922106768 1:222518859-222518881 CAGGTATTCCAACCTAATCCTGG + Intergenic
922266320 1:223987281-223987303 CAGGTATTCCAACCTAATCCTGG + Intergenic
1066727418 10:38408478-38408500 CAGGTATTCCAACCTAATCCTGG - Intergenic
1068180404 10:53511394-53511416 CAGTATGTCCTCCCTAATATTGG + Intergenic
1076048504 10:127313746-127313768 CAGGATATGCTGCCTAATGCTGG + Intronic
1079344796 11:19642463-19642485 CAGGAGTTCCTCCCTGATCCTGG + Intronic
1080146906 11:28996849-28996871 CAATATGTCCTACCTAATCCAGG + Intergenic
1083328005 11:61883375-61883397 CAGGATGTCCTACCTTTTTAAGG + Intronic
1087946400 11:104164884-104164906 CAGGATGCCCTGACTCATCCTGG - Intergenic
1092061509 12:5554991-5555013 CAGGATGTCCTCTCTAATTAGGG - Intronic
1093566206 12:20607068-20607090 CAGGATGTCCTACCTAATCCTGG - Intronic
1098064460 12:66598785-66598807 CAAGATGCCGTACCTAAGCCTGG - Intronic
1105723041 13:23135142-23135164 CAGGCTGTCCAACCTAGTGCAGG - Intergenic
1111790888 13:92852909-92852931 CAGCCTGACCTACCTTATCCTGG + Intronic
1118716766 14:68565274-68565296 CAGGATGTGCTGCCTTATCAGGG + Intronic
1122295382 14:100702766-100702788 CAGAATGTCCTTCCTTTTCCAGG + Intergenic
1123681539 15:22767833-22767855 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
1123761836 15:23439598-23439620 CAGGAGGTACTGCCTAATCCTGG + Exonic
1124333754 15:28842290-28842312 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
1126217816 15:46176593-46176615 GAGGATGTCCTGCAGAATCCAGG - Intergenic
1129295056 15:74595710-74595732 CACCAAGTCCTACCTCATCCCGG + Exonic
1129702052 15:77773835-77773857 CTGGCTGTCCTACCTACTCAGGG + Intronic
1130579028 15:85118257-85118279 CAGGGTTATCTACCTAATCCAGG + Intronic
1134865955 16:17607389-17607411 CAGGAAGTCCTGCCTGAGCCTGG + Intergenic
1139959393 16:70709072-70709094 CACCATTTCCTTCCTAATCCTGG + Intronic
1140407149 16:74718491-74718513 CAGGATGTCGTACCCCATTCTGG - Intronic
1151143254 17:72015767-72015789 GAGTATGTCCTAGCTAAACCAGG + Intergenic
1155044453 18:22091791-22091813 CAGGCTGTTCTACCTCGTCCTGG + Intronic
1155322745 18:24634319-24634341 CAGGAAGTCCTGCCCAAACCAGG - Intergenic
1162468667 19:10858791-10858813 CAGGATGTCCTAACTGGCCCTGG + Intronic
1165935874 19:39388749-39388771 CAGGACCACCTACCTAATCATGG + Exonic
926551848 2:14310545-14310567 CAAGATGTGCTACCTGCTCCTGG - Intergenic
935099056 2:99975045-99975067 TAGGATGGCCCACATAATCCTGG - Intronic
938241738 2:129747645-129747667 CAGGATGGCCTTTTTAATCCAGG + Intergenic
938858133 2:135337190-135337212 CATGTTGTCCTACCTACTTCTGG - Intronic
948099337 2:235360938-235360960 CAGGTTGCCCTACCTAATGTGGG + Intergenic
1177646148 21:23902051-23902073 CATGATGTCCTACCTAAAATAGG + Intergenic
1180188135 21:46150550-46150572 CAGGATGAGCTTCCTAGTCCAGG - Intronic
1182452067 22:30427549-30427571 CAGGCTGTCCTTTCTAACCCAGG - Intronic
1184085788 22:42263170-42263192 GAGGATGTGCAACCTCATCCTGG - Intronic
950187595 3:10954630-10954652 CACAATGTCCTTCCTGATCCAGG - Intergenic
950533006 3:13563877-13563899 CAGGAGCTCCCACCTCATCCAGG + Intronic
952478092 3:33731910-33731932 AAGGACGTCATCCCTAATCCAGG - Intergenic
954078768 3:48200295-48200317 CACGATGTCCTACCTGTCCCTGG + Intergenic
954948292 3:54446040-54446062 CAGGCAGTCCAACCTACTCCTGG - Intronic
955031202 3:55221276-55221298 CATGATGTCCTATCCATTCCTGG + Intergenic
964740012 3:159955233-159955255 CAGGATGACCTCCATCATCCTGG + Intergenic
965635330 3:170774884-170774906 CAGGATGTTCCACCTAACTCTGG + Intronic
969093222 4:4712507-4712529 CTGTATGTCCTGACTAATCCAGG - Intergenic
971119436 4:23687980-23688002 CAGGAAGTCTGACCTAGTCCAGG + Intergenic
971666808 4:29497502-29497524 CACTATCTCCTACATAATCCTGG + Intergenic
973737435 4:53886384-53886406 CTGGATGTGCTACAAAATCCGGG - Intronic
979254398 4:118596769-118596791 CAGGTATTCCAACCTAATCCTGG - Intergenic
979334566 4:119449262-119449284 CAGGTATTCCAACCTAATCCTGG + Intergenic
986392531 5:7299829-7299851 CAGGAGGTGCTGCCTAAGCCTGG + Intergenic
986891717 5:12317190-12317212 CAGTATGTGCTACATACTCCAGG + Intergenic
997542714 5:134677512-134677534 AAGGATCTCATACCCAATCCTGG - Intronic
998907757 5:146924728-146924750 CAGGATGGCCTACATAATTCTGG - Intronic
1006375136 6:33667826-33667848 CAGGATGTCGTAGCCAATCTGGG - Exonic
1007053737 6:38860148-38860170 CAGGAGGACCTAACTACTCCAGG - Intronic
1011723344 6:90182415-90182437 AAGGATTTCCTACCTCATCCAGG + Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024069491 7:45774417-45774439 CAGGTATTCCAACCTAATCCTGG - Intergenic
1024226822 7:47331873-47331895 CAGGCTGTCCTACTTAGGCCAGG - Intronic
1032046882 7:128618721-128618743 CAGGTATTCCAACCTAATCCTGG - Intergenic
1032157856 7:129484248-129484270 CAGTATGTCCTAGGTAATCTTGG + Intronic
1038765535 8:30424181-30424203 CAGGATGTCAAACCTAACACTGG - Intronic
1039711246 8:40057893-40057915 CAGAATGTCCTTCCTTATCAAGG + Intergenic
1044655966 8:94548964-94548986 CAGGCTGTCCTCCCAACTCCTGG + Intronic
1060324698 9:122602556-122602578 CATGACATCCTACCTAATCGTGG - Intergenic
1187629424 X:21152381-21152403 CAGGATGGCCTCCATCATCCAGG + Intergenic
1194405248 X:93488814-93488836 CAGGATATCATACCTCATCATGG + Intergenic
1194897892 X:99468563-99468585 CAGGATGTCCTTTTTAATCTGGG + Intergenic
1198975633 X:142332900-142332922 CAGGATGTCATTTTTAATCCAGG + Intergenic