ID: 1093570855

View in Genome Browser
Species Human (GRCh38)
Location 12:20664133-20664155
Sequence CTCAGGAAACATAATCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 11, 1: 53, 2: 66, 3: 52, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093570855_1093570859 -5 Left 1093570855 12:20664133-20664155 CCACCATGATTATGTTTCCTGAG 0: 11
1: 53
2: 66
3: 52
4: 291
Right 1093570859 12:20664151-20664173 CTGAGGCCTCCCCAGCCCTGTGG 0: 179
1: 2147
2: 5821
3: 6733
4: 5781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093570855 Original CRISPR CTCAGGAAACATAATCATGG TGG (reversed) Intronic
902820843 1:18942293-18942315 CTCTGGAAACATAGTCTTTGTGG - Intronic
902972220 1:20062083-20062105 CTCAGGAAGCTTAGTCATAGTGG - Intronic
904345197 1:29863455-29863477 CTCAAAAAACAAAATGATGGGGG + Intergenic
904823342 1:33258733-33258755 CTCAGGAAAGATTATGATGGCGG - Intronic
905688053 1:39922852-39922874 CTCAGTAAACTTATTCGTGGAGG + Intergenic
905698159 1:39991255-39991277 CTCAGTAAACTTATTCGTGGAGG + Intergenic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
907208892 1:52800859-52800881 CTGAAGAAACATAAACATGTAGG - Intronic
907633439 1:56107515-56107537 CTCAGGAAACCTGGTCATGAAGG + Intergenic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
908503886 1:64775014-64775036 CTCAGGATACAAAATCAATGTGG - Intronic
909259799 1:73472880-73472902 CTCAGAAAACACAATCATGGCGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
910826744 1:91417126-91417148 TTCAGGAAACTTAATAATCGTGG - Intergenic
910892392 1:92030966-92030988 CTCAGGAAACAGAATATTTGTGG - Intronic
911011014 1:93281026-93281048 CTTGGGAAACAAAATCGTGGTGG + Intergenic
911445781 1:97990152-97990174 CTCAGGAATGGAAATCATGGTGG + Intergenic
911727960 1:101262289-101262311 ATCAGGAAACATGATAATAGTGG + Intergenic
911735373 1:101331172-101331194 CTCAGGAAACTCAATCATGGTGG + Intergenic
911972283 1:104453316-104453338 CTCAGGAAATGTAGTCATGGAGG - Intergenic
912112876 1:106364524-106364546 CTCAGGAAACTTAGTCATGGTGG - Intergenic
912168799 1:107072082-107072104 TTGATAAAACATAATCATGGAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915886518 1:159728185-159728207 CTCAGGAAACACAATCAAGGTGG + Intergenic
916512361 1:165483578-165483600 CTCAGAAAACTTAATCATGGTGG + Intergenic
916888349 1:169092279-169092301 CTGAGAAAACATAATCACTGAGG - Intergenic
917648845 1:177056138-177056160 CACTGGAAACATGATCCTGGAGG + Intronic
918752582 1:188290884-188290906 CACAGGAAACCTAATCATGGTGG + Intergenic
919165628 1:193887930-193887952 CTCAGGAAACTTAATCGTGGCGG - Intergenic
919422186 1:197383705-197383727 CTCAGGAAACACTGGCATGGAGG - Intronic
920075758 1:203335321-203335343 CTCAGAAAACATAATAAGTGAGG + Intergenic
921465218 1:215478674-215478696 CTCAGGAAATTAAATTATGGTGG + Intergenic
921880651 1:220250867-220250889 CTCAGGAAACACAGTGGTGGAGG - Intronic
922067970 1:222162534-222162556 CTCAGGAAAGATAAAGATGAAGG - Intergenic
922174001 1:223180751-223180773 CTCAGGAAACAAACTCATGCAGG - Intergenic
923179026 1:231498414-231498436 ATCAGGAAACACAATCATGGTGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
924006398 1:239616619-239616641 CTCAGGAAATATAATACTGCTGG - Intronic
1063129836 10:3168712-3168734 CTCAGGAAACACAATCGTGGTGG - Intronic
1063783085 10:9349441-9349463 CTCAGGAAACTTAATCGTGGTGG + Intergenic
1064039140 10:11943424-11943446 CTCAGGAAACTTCTTCATTGTGG - Intronic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066069802 10:31796102-31796124 CTCTGAAAACATAAACAAGGTGG + Intergenic
1066128138 10:32362520-32362542 CTTAGGAAACATAGTCATGGTGG - Intronic
1066469726 10:35687088-35687110 CTCAGAAACCATAAACACGGTGG + Intergenic
1067211446 10:44262961-44262983 ATAATGTAACATAATCATGGGGG - Intergenic
1068823693 10:61409335-61409357 CTCAGGGAACATGGTGATGGAGG - Exonic
1068944120 10:62711439-62711461 TTCAGGAATCTTAATCATGATGG + Intergenic
1071161001 10:82745087-82745109 CTAAGGAAATATAAAAATGGAGG + Intronic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1071860624 10:89669047-89669069 CTTAGGGAACTTAGTCATGGCGG + Intergenic
1072061849 10:91820781-91820803 ATCAGGATCCATAATAATGGTGG + Intronic
1072641825 10:97216730-97216752 CTCAGGAAACACAATTATGGTGG - Intronic
1072654420 10:97320077-97320099 CTCTGGAAACCTCATCAAGGAGG + Exonic
1078050333 11:7960293-7960315 CTCAGGAAACATAATTTAGATGG - Exonic
1078815337 11:14815623-14815645 ATAATGAAACATAATCATAGGGG + Intronic
1079114035 11:17629255-17629277 CTCAGGACTCATGATCGTGGAGG + Exonic
1080278470 11:30529298-30529320 CTTTGGAAATATAATTATGGAGG + Intronic
1080902941 11:36512721-36512743 TTCAGGAAACCTGATCATTGTGG - Intronic
1080986286 11:37470365-37470387 CTCAGGAAACTTAATGATCATGG + Intergenic
1081003145 11:37699734-37699756 CTAAGGAACCATAATCATGGTGG + Intergenic
1083018248 11:59478580-59478602 ATCATGAAACAAAATCTTGGTGG - Intergenic
1085162815 11:74364517-74364539 CTCAGGATACAAAATCAATGTGG + Intronic
1085180182 11:74528093-74528115 CTCAGGATACAAAATCAATGTGG - Intronic
1085767413 11:79295249-79295271 CTCAGGAAAGATAATCACTCTGG + Intronic
1086608832 11:88729178-88729200 CTCAGGATACAAAATCAATGTGG + Intronic
1086731173 11:90251258-90251280 CTCAGGAAAAATATTCGTGGTGG - Intergenic
1087077278 11:94136932-94136954 CTCGGGAAACACAGTCATGGCGG + Intronic
1087520777 11:99232489-99232511 CTCAGGATACAAAATCAATGTGG - Intronic
1087708199 11:101519608-101519630 CTCAGAAAAAAAAATCATGGTGG + Intronic
1087885698 11:103479805-103479827 TTCAGGTGACATAATAATGGAGG + Intronic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1092332524 12:7598476-7598498 CTCAGGATACAAAATCAATGTGG + Intergenic
1092495260 12:8986959-8986981 CTCAGGAAACTTAGTCATGGTGG - Intronic
1092940394 12:13402376-13402398 CTCAGGAAACTTAACAATCGTGG - Intergenic
1093188964 12:16053113-16053135 CTCAGGATACAAAATCAATGTGG + Intergenic
1093276337 12:17132744-17132766 CTCAGGATACAAAATCAGTGTGG + Intergenic
1093336428 12:17911303-17911325 TTCAGGAAACATAAAAATGCAGG - Intergenic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1093714910 12:22370220-22370242 CTCAGGATACAAAATCAATGTGG + Intronic
1093819049 12:23589396-23589418 CACAGTAAACAAACTCATGGAGG + Intronic
1095109747 12:38279935-38279957 CTCAGGAAACTTAGTCATGGTGG - Intergenic
1095199352 12:39364413-39364435 CTTAGGAGATATAATCATGGTGG - Intronic
1095786282 12:46111451-46111473 CTCAGTAAATAAAATCCTGGCGG + Intergenic
1098198355 12:68026628-68026650 CTGAGGAAACAGAATCACGGTGG - Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1099400068 12:82193097-82193119 CTGGGGAGACACAATCATGGTGG - Intergenic
1099500091 12:83403420-83403442 CTCAGGATACAAAATCAATGTGG + Intergenic
1100216774 12:92458528-92458550 ATCAGGAAACACAATCATGGTGG + Intergenic
1100864143 12:98837996-98838018 ACCACAAAACATAATCATGGGGG - Intronic
1101702628 12:107189360-107189382 CTCAGGATACAAAATCAATGTGG + Intergenic
1102600162 12:114023593-114023615 CTCAGGAAACTTAGTCATGGCGG - Intergenic
1103031832 12:117621246-117621268 CTCAGGAAACTTAGTTATGGTGG - Intronic
1107106937 13:36653928-36653950 CTCAGAAAATAGAATCATTGTGG + Intergenic
1107564814 13:41591026-41591048 ATCTGGAAATATAATAATGGGGG + Intronic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1108170719 13:47739061-47739083 CTCAGGATACAAAATCAATGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1110430776 13:75420681-75420703 CTCAGGAAGCATAATTGTGTGGG - Intronic
1111183880 13:84703318-84703340 CTAAGGAAACATATTCTTGGAGG - Intergenic
1111483878 13:88869251-88869273 CTCAGGAAATAAAATCATGGTGG - Intergenic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1113450881 13:110408398-110408420 TTCAGGAAGCATGGTCATGGAGG - Intronic
1113499862 13:110764688-110764710 TTCAGGCAACACAATCATGGCGG - Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1115522560 14:34247365-34247387 CTCAGAAAACAGAATTATGAAGG - Intronic
1116712917 14:48391935-48391957 CTCAGGAAACTTAGTCATGGCGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1116827430 14:49686299-49686321 CTGAGGCAACCTAATCAAGGAGG - Intronic
1117153994 14:52919639-52919661 CTCAGAAAACAGAATCCTGAGGG + Intronic
1118046340 14:61975479-61975501 CTCAGCAAACTTAATCATGATGG + Intergenic
1118369508 14:65125487-65125509 CTCAGGAAACACAATCATAGTGG + Intergenic
1119529902 14:75352705-75352727 CTAAGGGAAAATAATCAAGGAGG - Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1120959619 14:90112761-90112783 CTCAGGAAAATTGATCTTGGTGG + Intronic
1123411200 15:20061270-20061292 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1123520546 15:21068381-21068403 CTCAGGAAACTCAGTCACGGTGG - Intergenic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1125331295 15:38585012-38585034 CTCAGGATACAAAATCAATGTGG + Intergenic
1127703976 15:61529099-61529121 CTCTGGAAACCTACTCAAGGCGG + Intergenic
1127744006 15:61945138-61945160 CTCAGGAAACTGAATCATGGTGG - Intronic
1128845971 15:70894983-70895005 CTCTAGAAACATTATAATGGTGG - Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1131646914 15:94354537-94354559 CTCAGGAAACTTAATCACCATGG - Intronic
1132017717 15:98333452-98333474 CCCAGGAAACATAAGCAGAGTGG + Intergenic
1132035084 15:98476099-98476121 CTCAGGAAAAAAAATAATGGTGG + Intronic
1133129637 16:3668878-3668900 CTCAGGAAACACATTCAGGATGG + Intronic
1133697641 16:8280140-8280162 ATAAGGTAACCTAATCATGGAGG - Intergenic
1135759047 16:25121612-25121634 CTCAGGAAACTTAGTCATGGCGG + Intronic
1137247746 16:46719376-46719398 CGGAGGAAACAGAATCCTGGAGG + Intronic
1137549084 16:49424550-49424572 CAAAGGAAAGAAAATCATGGAGG + Intergenic
1138437662 16:57014126-57014148 CTTGGGAAACATCATCATGATGG + Intronic
1138683130 16:58701307-58701329 CTCAGGAAACTTAACAATCGTGG - Intergenic
1140715022 16:77715555-77715577 CTCAGGAAAGGTACACATGGGGG - Intergenic
1143427340 17:6850498-6850520 CTCAGGAAACAAAATCATGATGG + Intergenic
1146624347 17:34424450-34424472 CTCAGGAAACACTGTTATGGGGG - Intergenic
1147557120 17:41486572-41486594 CTGAGGAAACAAAATCATGCAGG + Intronic
1148219762 17:45853177-45853199 CTGAGGACACTTATTCATGGTGG - Intergenic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1148925771 17:51083706-51083728 ATCAGGAAAGTTAAACATGGTGG - Intronic
1149031278 17:52085339-52085361 AACAGGAAACATAATCATGCAGG - Intronic
1149050432 17:52297888-52297910 CTCAGGAAACAGAATCACGGTGG - Intergenic
1149138865 17:53404985-53405007 CTCAGGAAACTTACACATGGTGG - Intergenic
1149366327 17:55948806-55948828 CTCAGGATACAAAATCAAGCTGG - Intergenic
1150052352 17:61977450-61977472 CTCAAGAAAAATAATAATGTTGG - Intronic
1150459797 17:65340139-65340161 CTCAAGGAACAAAACCATGGGGG + Intergenic
1151194079 17:72419755-72419777 CTCAGGTCACATAACCATTGGGG - Intergenic
1152165821 17:78704915-78704937 CTTAGGAAACAAAGTCATGGGGG + Intronic
1153094716 18:1387567-1387589 CTCAGGATACAAAATCAATGTGG + Intergenic
1153433698 18:5046382-5046404 CTCAGGAAACTTAACAATTGTGG - Intergenic
1155700723 18:28739584-28739606 ATCAGGAAAAATTTTCATGGTGG + Intergenic
1155816733 18:30320828-30320850 TTCAGGAAGCTTCATCATGGTGG + Intergenic
1156615961 18:38784414-38784436 CTCAAAAAACTTAATCATGGTGG + Intergenic
1157131852 18:45014581-45014603 CTCAGGAAACAAAAACATCGAGG + Intronic
1158036807 18:53041846-53041868 CTCAGGATACAAAATCAATGTGG - Intronic
1158107281 18:53899922-53899944 CTCAGGAAACTTAGTCATGATGG - Intergenic
1159227324 18:65556242-65556264 CTCAGGATACAAAATCAATGTGG - Intergenic
1161340305 19:3738278-3738300 CTCAGATAACCAAATCATGGTGG - Intronic
1161733250 19:5975228-5975250 CTCAGGAAATCAAATCTTGGTGG - Intronic
1162593404 19:11608053-11608075 CTCAGGAAACTTAATCATGACGG + Intronic
1164751572 19:30659227-30659249 CTCAAGAAACTTAGTCATGGTGG + Intronic
1164810316 19:31149872-31149894 CTTATGAAACTTAATCATAGAGG + Intergenic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1168562434 19:57395495-57395517 CTCAGGAAACACAATCCTGGCGG + Intronic
925053151 2:832874-832896 CTCAGGAAACTTAGTCGTGGGGG - Intergenic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
925246739 2:2390215-2390237 CTCAGGAAACACAGTGATGGTGG + Intergenic
925323492 2:2996639-2996661 CCCAGGAAACAGATTCAAGGAGG + Intergenic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
925482272 2:4288921-4288943 CTCAGGAAGCAGGATCATGGCGG + Intergenic
925876578 2:8316458-8316480 CTCAGGAAACTTAACCATCATGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926316662 2:11715161-11715183 CGCAGGCCACATAGTCATGGAGG + Intronic
926582428 2:14645709-14645731 CAAAGGAAACAAAATCATTGTGG - Intronic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928475788 2:31626195-31626217 CTCAGGATACAAAATCAATGTGG - Intergenic
928620295 2:33081924-33081946 CTCAGGAAACTTAACAATCGTGG - Intronic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
929351216 2:40957730-40957752 CTCAGGAAACTGAATCATGGAGG + Intergenic
929902858 2:46020964-46020986 CTAAGGAAACAGACTCAGGGAGG + Intronic
930131590 2:47857560-47857582 ATCAATAAAAATAATCATGGGGG + Intronic
930521206 2:52469920-52469942 CTCTGGAAACATAATCATGATGG - Intergenic
931808099 2:65827538-65827560 CTTAGGATACCTTATCATGGGGG + Intergenic
932320664 2:70819969-70819991 CCCAGGAAACAGAATCAGAGAGG - Intronic
932848134 2:75155653-75155675 CACAAGAAATATAATAATGGAGG - Intronic
933864279 2:86501606-86501628 CTCAGGAAACACAGTCGTGGCGG + Intergenic
933949619 2:87317370-87317392 CTCAGGAAACACAATTATGGTGG + Intergenic
935868689 2:107420903-107420925 CTCAGGAAACACAATCATGATGG + Intergenic
936330574 2:111544227-111544249 CTCAGGAAACACAATTATGGTGG - Intergenic
936338169 2:111608312-111608334 GTCAGGAAACAGGATCCTGGAGG - Intergenic
937761184 2:125604917-125604939 GTGAGGTAACTTAATCATGGGGG + Intergenic
937850006 2:126623568-126623590 CCCAGGAGGCATAATCACGGAGG - Intergenic
939147132 2:138429224-138429246 CTCAGGAAACATGATCATAGTGG - Intergenic
939546754 2:143564226-143564248 CCCATGTAACATAATCATGAAGG + Intronic
940724361 2:157319053-157319075 CTCAGGTAACATAATGGTGATGG - Exonic
941524761 2:166593083-166593105 CTTAGGAAACACTATTATGGTGG - Intergenic
942568659 2:177291289-177291311 CTCAAGAAAAATAATAATGCAGG - Intronic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
942736428 2:179119547-179119569 CTCAGGAAACAGAATCGTGGTGG - Intronic
944995854 2:205292507-205292529 CACAGGAATCATACTCAGGGTGG + Intronic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
946548821 2:220777681-220777703 CTCAGGAATCAAAATCGTTGGGG + Intergenic
946867358 2:224054176-224054198 CTCAGGCAACATACTAAGGGTGG + Intergenic
947084527 2:226436327-226436349 CAGAGGTCACATAATCATGGCGG + Intergenic
947232809 2:227904967-227904989 CTCAGGAGACAGAATCATCACGG + Exonic
947995396 2:234523116-234523138 CTCAGGAAACACAATAATGGCGG - Intergenic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
948209700 2:236183706-236183728 CTCAGGAAGCTCAATCATGGTGG - Intergenic
1173329422 20:42062105-42062127 CTCAGGAAGAACAATCCTGGGGG - Intergenic
1173645540 20:44631143-44631165 CTTAGGAAACATATTTATGTAGG - Intronic
1173943649 20:46932987-46933009 CTCAGGAAACACAATCATGTTGG - Intronic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1176277205 20:64279157-64279179 CTCAGGGAACATCTTCAGGGAGG + Intronic
1177285468 21:19042867-19042889 CTCAGGAAACATCATCTTGGAGG + Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1178609090 21:34064812-34064834 CTCAGGATTCAAAAGCATGGGGG + Intergenic
1179230400 21:39498950-39498972 CTCAGGAAACTTAGTCATGGTGG + Intronic
1179414054 21:41184203-41184225 CTCAGGAAATATACTAATGCAGG - Intronic
1179924070 21:44522764-44522786 CTCAGGAAACAAGGCCATGGAGG + Intronic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1182111022 22:27723785-27723807 CTCAGGACTCATCTTCATGGAGG + Intergenic
1182950560 22:34371442-34371464 CTCAGGAACCAGATTAATGGAGG - Intergenic
1183849761 22:40575111-40575133 CACAGGAAACTTAGGCATGGAGG - Intronic
1184584698 22:45440059-45440081 ATCAGAAATCATAATCAGGGCGG + Intergenic
1184956412 22:47889772-47889794 CTCAGGAAACACAATTATGGTGG - Intergenic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
949135204 3:556231-556253 CTCAGGAGACACAATTATGATGG + Intergenic
949491675 3:4595268-4595290 TTCAGGAAACTTTGTCATGGTGG + Intronic
949521224 3:4855857-4855879 CTCAGGAAACTTAGTCATGGCGG - Intronic
949694536 3:6679469-6679491 ACCAGGAAACCTAATCATGTGGG - Intergenic
950487947 3:13283751-13283773 CTCAGCAAATAGAACCATGGAGG - Intergenic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951180489 3:19653674-19653696 CTCAGGAAACACAATCATGACGG + Intergenic
951414734 3:22410404-22410426 CTCAGGATACAAAATCAATGTGG - Intergenic
952014938 3:28945309-28945331 CTCAGAAAACAAAATGATGGGGG - Intergenic
952120141 3:30232462-30232484 CTCAGGAAACACAATCAAGGTGG + Intergenic
952221240 3:31326367-31326389 CTCAGGAAACTCAATCATGGTGG + Intergenic
953835298 3:46338197-46338219 CTCAGGAAACACAGTTATGATGG + Intergenic
955091814 3:55759630-55759652 CCCTTGCAACATAATCATGGAGG + Intronic
955644726 3:61124928-61124950 CTGATGAAACATCAGCATGGAGG - Intronic
956044139 3:65177242-65177264 CCCAAGAAACACAATCATGATGG + Intergenic
956356096 3:68394106-68394128 CTCAGGATACAAAATCAATGTGG + Intronic
956868014 3:73388277-73388299 CTCATGAACTATACTCATGGAGG - Intronic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
957847407 3:85755622-85755644 CTCAGGAAACTCAATCATGGTGG + Intronic
958679134 3:97304080-97304102 CTCAGGATACAAAATCAATGTGG - Intronic
958703210 3:97619570-97619592 CTCAGGATACAAAATCAATGTGG + Intronic
959351398 3:105269146-105269168 CTCAGGAAACAAAATCCTGGTGG - Intergenic
959988261 3:112600808-112600830 TTCAGGAAATATAATAATGAGGG - Intergenic
960722435 3:120638117-120638139 CTCAGGAAATACAATCATGGTGG - Intronic
962524855 3:136228583-136228605 CTCAGGATACAAAATCAATGTGG + Intergenic
962553693 3:136524433-136524455 CTCAGGATACAAAATCAATGTGG - Intronic
963245987 3:143063156-143063178 CTCAGGAAGCTTAGTCATGGTGG - Intergenic
964033459 3:152167011-152167033 CTCAGGATACAAAATCAATGAGG + Intergenic
964090365 3:152868796-152868818 ATCAGGGGACATAAGCATGGTGG - Intergenic
964256612 3:154781727-154781749 CTCTGCAAACATAATTCTGGTGG + Intergenic
965100307 3:164289597-164289619 CTCAGGAAATACGATCATGGCGG + Intergenic
965112629 3:164447526-164447548 CTTAGGATACTTACTCATGGTGG - Intergenic
965224488 3:165971309-165971331 CTCAAGAAACACAATCATTGTGG - Intergenic
965291121 3:166882271-166882293 CTCAGGATACAAAATCAATGTGG - Intergenic
965394910 3:168151775-168151797 CTCAGGAAACTTAAGCATGGTGG - Intergenic
965525820 3:169717089-169717111 CTCAGGATACAAAATCAACGTGG + Intergenic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966342921 3:178945543-178945565 CTCAGGAAACTTAACCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
968290748 3:197537686-197537708 CTCAGGAAAAATAGACATAGAGG - Intronic
968524445 4:1048857-1048879 CTCAGGAAACTTAGTCATGGTGG + Intergenic
968970435 4:3790950-3790972 CTCAGGAAACATGAGCAGGAAGG - Intergenic
968971820 4:3799694-3799716 CTCAGGGAAAAGCATCATGGCGG + Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969136103 4:5030047-5030069 CTCAGGAAACTTAACCATCATGG - Intergenic
970088190 4:12371402-12371424 CTCAGTATACATTATCAAGGTGG - Intergenic
970100254 4:12513771-12513793 TTTAGGAAACATAATCATGGTGG - Intergenic
970582597 4:17487175-17487197 CTCAGGAAGCCTAATCCAGGTGG - Exonic
971119796 4:23690470-23690492 CTCAGGAAACTTAACCATCTTGG - Intergenic
971561097 4:28080496-28080518 CTCAGGATACAAAATCAATGTGG + Intergenic
971858782 4:32078367-32078389 TTCAGGAAACATATTTATCGAGG + Intergenic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
974958198 4:68669557-68669579 CTCAAGAAACATCTTCATGAAGG - Intronic
975401716 4:73945587-73945609 CTCTGGAAACATAGGCATTGTGG + Intergenic
975514078 4:75225654-75225676 CTCAGGATACAAAATCAATGTGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
977077769 4:92479138-92479160 TTCAGAAAAAATAATAATGGTGG + Intronic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
977970114 4:103203224-103203246 TTCAGAAAACACAATCATGGTGG + Intergenic
979141286 4:117178284-117178306 CTCAGGATACAAAATCAACGTGG - Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
979743712 4:124182257-124182279 CGAAGGACTCATAATCATGGTGG - Intergenic
980089361 4:128426097-128426119 CTCAGGAAACCTCATCATTATGG - Intergenic
980625334 4:135367951-135367973 CTCAGTAAACATACTAATAGGGG - Intergenic
981273459 4:142870667-142870689 CTCAGGATACAAAATCAATGTGG + Intergenic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
982038757 4:151373719-151373741 CTTGGGCAAGATAATCATGGAGG - Intergenic
982272861 4:153609213-153609235 CTTAGGAAACACAGTTATGGTGG + Intronic
982623751 4:157738152-157738174 CTCGGGAAACAAAAGCATGGTGG + Intergenic
983020146 4:162665971-162665993 CTCAGGAAACCTAATCACCCAGG - Intergenic
983105765 4:163683810-163683832 CTCAGCAAAGATAATCCTTGGGG + Intronic
983694041 4:170506903-170506925 CTCAGGATACAAAATCAATGTGG - Intergenic
984024627 4:174528432-174528454 CTCAGGAAACAGGATCAGAGAGG - Intergenic
984143944 4:176038371-176038393 ATCAGGAAAAATAACCAAGGGGG - Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
984796534 4:183665392-183665414 CTAAAGAAAAATAATCATGTAGG - Intronic
984854368 4:184181163-184181185 CTCAGGATACAAAATCAATGTGG + Intronic
985395288 4:189537191-189537213 CTCAGGAAACAGAATCTTTCTGG - Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
987566160 5:19589341-19589363 CGGAGGAAATATAATCTTGGAGG - Intronic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989179158 5:38558672-38558694 CTCAGGAAACTTAACAATCGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989254548 5:39352054-39352076 CTCAGGAAACCCAATCATGGTGG + Intronic
989386098 5:40855937-40855959 CTCAGGAAACACAATCATGATGG - Intronic
989766748 5:45095019-45095041 CTCAGGACACAAAATCAATGTGG - Intergenic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
991482266 5:67093743-67093765 ATCACAAAACAAAATCATGGTGG + Intronic
991992245 5:72351583-72351605 CTCAGGAAATACAGTCATGGGGG + Intronic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
993800014 5:92320603-92320625 CTCAGGAAATGCAATCATGCTGG - Intergenic
995092281 5:108192534-108192556 CCTAGGAAACATAAGCTTGGTGG + Intronic
995576421 5:113540502-113540524 CTCAGGAAACTTAGTCATGATGG + Intronic
995895672 5:117007599-117007621 CTCAGGAAACTTACACATGGTGG + Intergenic
998778751 5:145632758-145632780 ATAATGTAACATAATCATGGAGG - Intronic
1000145699 5:158451287-158451309 CTCAGCAAACCTTTTCATGGTGG + Intergenic
1000174758 5:158740756-158740778 CTCAGCAAAAATAATCATTTAGG - Intronic
1003205016 6:4000859-4000881 CTCAAAACACATACTCATGGAGG + Intergenic
1005078228 6:21929749-21929771 CTCAGGAAATGCAGTCATGGCGG + Intergenic
1005229155 6:23680242-23680264 CTCTGGAAACATAATTATATAGG - Intergenic
1005879776 6:30047260-30047282 CTCAGGAAACACAATAATGGTGG + Intergenic
1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG + Intergenic
1008209858 6:48707734-48707756 CACAGAAAAAAAAATCATGGAGG - Intergenic
1008494011 6:52114606-52114628 CTCAGGCCCCATATTCATGGTGG - Intergenic
1008782154 6:55120590-55120612 CTCAGGATACAAAATCAATGTGG - Intronic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1010047142 6:71458508-71458530 CTCAGGGAACATAATCAACCAGG + Intergenic
1010789619 6:80049924-80049946 CTCAGGATACAAAATCAATGTGG - Intergenic
1011016153 6:82758147-82758169 CTCAGGATACAAAATCAATGTGG + Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011751137 6:90456021-90456043 TTCAGGAAATATAAGCAAGGGGG + Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1011989131 6:93490491-93490513 CTCAGGAAATAGAATTCTGGGGG + Intergenic
1012942802 6:105433815-105433837 CACAGGACACACAATCATAGTGG + Intergenic
1013487003 6:110606868-110606890 CTCAGGAAATACAATCACAGTGG + Intergenic
1014250016 6:119105487-119105509 CTCAGGAAACTGAATCATGGTGG - Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1015239472 6:131007325-131007347 CTCAGGAAACAAAGTTACGGTGG - Intronic
1015599909 6:134902027-134902049 CTCAGGTCACATAAGAATGGAGG - Intergenic
1015726540 6:136305289-136305311 CTCAGGAAAGATACTAATGCTGG + Intergenic
1015772376 6:136782446-136782468 CTTAAGAAACAGAAACATGGAGG - Intronic
1016619525 6:146091901-146091923 CTCAAGAAACACAAACATGGTGG + Intronic
1016621889 6:146120275-146120297 CTCAGGATACAAAATCAATGTGG - Intronic
1016737729 6:147498177-147498199 CTGAGGAAACAAAATCATTCAGG - Intergenic
1017408968 6:154149190-154149212 CTCAGGAAACTTAACAATCGTGG + Intronic
1018511288 6:164527109-164527131 CTCAGCAAACATAATTATGGAGG - Intergenic
1018552998 6:165020179-165020201 CTTGGCACACATAATCATGGAGG + Intergenic
1021779656 7:24090398-24090420 CTCAGGGAATATAATGGTGGTGG + Intergenic
1022120008 7:27298906-27298928 CTCAGAAATTGTAATCATGGAGG + Intergenic
1022858250 7:34338609-34338631 CTCAGGAAACTTAACCATCATGG + Intergenic
1024865685 7:53903368-53903390 CTCAGGAAACTTTCACATGGTGG + Intergenic
1024895874 7:54261344-54261366 CTCAGGAAACACAGTCATGGTGG + Intergenic
1027441405 7:78222993-78223015 CTCATGAAACATGGTTATGGGGG + Intronic
1027542427 7:79484134-79484156 CACAGAAAACTTGATCATGGGGG + Intergenic
1028385567 7:90249307-90249329 CTCAAGAAAAACAGTCATGGCGG - Intronic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1028412617 7:90547236-90547258 CTCAGGATACAAAATCAATGTGG - Intronic
1028432012 7:90758663-90758685 CTCGGGAAACTTAATCTTGAAGG + Intronic
1028610835 7:92709853-92709875 CTAAGGAATCATAGTCCTGGTGG + Intronic
1028625534 7:92872788-92872810 CTAAGGAACCATAAACTTGGAGG + Intergenic
1028643398 7:93069333-93069355 CTCAGGATACAAAATCAATGTGG - Intergenic
1029039874 7:97561819-97561841 CTCAGGATACAAAATCAATGTGG + Intergenic
1031194079 7:118590333-118590355 CTCAGGAAACTCAAACATGGTGG - Intergenic
1031410878 7:121438953-121438975 CTCAGGATACACAATCAATGTGG + Intergenic
1031433903 7:121709299-121709321 CTCAGGATACAAAATCAGTGTGG - Intergenic
1031721106 7:125177728-125177750 CTCAGGATACAAAATCAATGTGG + Intergenic
1032007376 7:128313863-128313885 CTCAGGAAACTTAATCATAGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1032846801 7:135758244-135758266 CTCAGGAGAAATAGTCAGGGAGG + Intergenic
1033653192 7:143357021-143357043 ATCTGGAAAAAGAATCATGGAGG + Exonic
1033790781 7:144790512-144790534 CTCAGGAAACTTAACAATCGTGG + Intronic
1033845519 7:145427342-145427364 CTCAGGAAAGACAATAACGGAGG - Intergenic
1034113616 7:148562814-148562836 CTTAGGAAACTTAGTCATGGCGG + Intergenic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1034778286 7:153852355-153852377 CTCAGGGAACTTAGTCATGATGG + Intergenic
1034824971 7:154253856-154253878 CTTAGGAAACACAATTATGGTGG + Intronic
1035634562 8:1134719-1134741 CTCAGGAAACTTATTCATGGTGG + Intergenic
1036057275 8:5270231-5270253 CTCAGGAAACACATTCATGGAGG - Intergenic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1037294448 8:17385782-17385804 CACAGGAAACACAATCATGGTGG - Intronic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1037685387 8:21134799-21134821 CTCAGGATACAAAATCAGTGTGG - Intergenic
1040362668 8:46682835-46682857 CTCAGCAAATAAAATAATGGGGG - Intergenic
1040711677 8:50195941-50195963 CTCAAGAATCATCATCATGGAGG - Intronic
1040741489 8:50580710-50580732 CTCAAGAAACACAGTCATGATGG - Intronic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1042030581 8:64471584-64471606 CTTAAGAAACAAACTCATGGTGG + Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1043923502 8:86010724-86010746 CTCAGGATACAAAATCAATGTGG - Intronic
1043953815 8:86339325-86339347 GTCAGGTAATTTAATCATGGGGG - Intergenic
1044221195 8:89672250-89672272 CTCTGGAAACAAAATCATGGTGG + Intergenic
1045134786 8:99203666-99203688 CTCAGGATACAAAATCAATGTGG + Intronic
1045389144 8:101698087-101698109 CTCAGGATACAAAATCAATGTGG + Intronic
1046365661 8:113227722-113227744 CTCAGAAAACATAATTATGGTGG - Intronic
1046611378 8:116429417-116429439 CTCAGGAAACACAGTCATGGTGG + Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1047827904 8:128597782-128597804 CTCACAAAACTTAGTCATGGTGG + Intergenic
1050333205 9:4566040-4566062 CTCAGGGAACATATTCCTGTTGG - Exonic
1050843660 9:10186916-10186938 CTCAAGAACATTAATCATGGGGG - Intronic
1051467489 9:17396854-17396876 CTCAAAAAACATATTCATGAAGG + Intronic
1052133549 9:24881812-24881834 CTCAACTAAAATAATCATGGTGG - Intergenic
1052241781 9:26281709-26281731 CTCAGGATACAAAATCAATGTGG + Intergenic
1054819071 9:69504100-69504122 ATCAGGAAACACAATGATGTTGG - Intronic
1054989646 9:71308636-71308658 CTCAGCAAACAAAGTAATGGGGG + Intronic
1055218904 9:73903912-73903934 CTTAGGAAACAGGATAATGGTGG + Intergenic
1055856711 9:80697041-80697063 CTTGGGAAACACAATCATGGTGG + Intergenic
1055926895 9:81519612-81519634 CTCAGGAAACTTAGTGATGGTGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1058209057 9:102144622-102144644 CACAGGAAACTTAGTCATGGTGG + Intergenic
1058303890 9:103412077-103412099 CTCAGGAAGCAAAATAATGTGGG + Intergenic
1058591465 9:106569780-106569802 CTCAGGATACAAAATCAATGTGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1187599713 X:20814656-20814678 CTCAGGAAACATAGACATTAAGG - Intergenic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1188560827 X:31467002-31467024 CTCAGGATACAAAATCAATGTGG - Intronic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1191001688 X:55666258-55666280 CTCAGGATACAAAATCAATGTGG - Intergenic
1192025749 X:67449636-67449658 CTCAGGATACAAAATCAATGTGG + Intergenic
1192177510 X:68895165-68895187 CTGAGGAAGCATAATCATGCTGG - Intergenic
1192695692 X:73413477-73413499 CTCAGAAAACTTAATCTTGGAGG - Intergenic
1192766192 X:74142081-74142103 CTCAGGATACAAAATCAATGTGG + Intergenic
1192782983 X:74312958-74312980 GTTAGGAGACATAATCATGAAGG + Intergenic
1193244887 X:79216323-79216345 CTCAGGATACAAAATCAATGTGG - Intergenic
1194039909 X:88927979-88928001 CTCAGGATACAAAATCAATGTGG + Intergenic
1194274303 X:91860304-91860326 CTCAGGATACAAAATCAGTGTGG - Intronic
1194390877 X:93316390-93316412 CTCAGGATACAAAATCAATGTGG - Intergenic
1194507758 X:94754000-94754022 CTTAGGAAACATAATCATAATGG + Intergenic
1195042727 X:101028932-101028954 CTCAGGACACACTATCATGGTGG - Intronic
1197123620 X:122919159-122919181 CTCAGGATACAAAATCAATGTGG + Intergenic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198797724 X:140416700-140416722 ATCATGAAACAGAATCATGGGGG - Intergenic
1198895709 X:141452212-141452234 CTCAGGATACAAAATCAATGTGG + Intergenic
1198999964 X:142624121-142624143 CTCAGGGAACTTACTCGTGGCGG + Intergenic
1200591543 Y:5081710-5081732 CTCAGGATACAAAATCAGTGTGG - Intronic
1200739457 Y:6837434-6837456 CTCAGGAAACACAATAATTGTGG - Intergenic
1200890185 Y:8315064-8315086 CTCAGGAACCAGGATCAAGGTGG + Intergenic
1200915296 Y:8566119-8566141 CTCAGGAAAGATAAAAAGGGGGG - Intergenic
1201331768 Y:12831072-12831094 CTTAGGAAACTTAATCATGGTGG - Intronic
1201608571 Y:15815297-15815319 CTCAGGAATGATAAACATGGTGG + Intergenic
1202038239 Y:20656646-20656668 CTCAGTAAATAAAATCCTGGGGG + Intergenic
1202061115 Y:20889283-20889305 CTCAGGATACAAAATCAATGTGG + Intergenic
1202166870 Y:21998847-21998869 CTCAGGATACAAAATCAATGTGG + Intergenic
1202224490 Y:22587526-22587548 CTCAGGATACAAAATCAATGTGG - Intergenic
1202245240 Y:22813295-22813317 CTCAGGAATCAGGATCAAGGCGG + Intergenic
1202318624 Y:23608134-23608156 CTCAGGATACAAAATCAATGTGG + Intergenic
1202398230 Y:24447041-24447063 CTCAGGAATCAGGATCAAGGCGG + Intergenic
1202472551 Y:25223045-25223067 CTCAGGAATCAGGATCAAGGCGG - Intergenic
1202552143 Y:26061923-26061945 CTCAGGATACAAAATCAATGTGG - Intergenic