ID: 1093573381

View in Genome Browser
Species Human (GRCh38)
Location 12:20695502-20695524
Sequence GACGTGCATCTCAGCTCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093573381_1093573388 28 Left 1093573381 12:20695502-20695524 CCCTGGGAGCTGAGATGCACGTC 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1093573388 12:20695553-20695575 TGCTGACTGCCAGAAAAAAGAGG 0: 1
1: 0
2: 2
3: 28
4: 237
1093573381_1093573384 -4 Left 1093573381 12:20695502-20695524 CCCTGGGAGCTGAGATGCACGTC 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1093573384 12:20695521-20695543 CGTCAGTGGCCTTGCCAGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093573381 Original CRISPR GACGTGCATCTCAGCTCCCA GGG (reversed) Exonic