ID: 1093581562

View in Genome Browser
Species Human (GRCh38)
Location 12:20790021-20790043
Sequence GCTGTTTGGGAGCCAGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093581556_1093581562 4 Left 1093581556 12:20789994-20790016 CCCCACGCTGTGGGCGTGTCTAG No data
Right 1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG No data
1093581553_1093581562 28 Left 1093581553 12:20789970-20789992 CCTTTTCTTTATGGTGGTGAGTT No data
Right 1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG No data
1093581558_1093581562 2 Left 1093581558 12:20789996-20790018 CCACGCTGTGGGCGTGTCTAGCA No data
Right 1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG No data
1093581557_1093581562 3 Left 1093581557 12:20789995-20790017 CCCACGCTGTGGGCGTGTCTAGC No data
Right 1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093581562 Original CRISPR GCTGTTTGGGAGCCAGGAAT TGG Intergenic
No off target data available for this crispr