ID: 1093583659

View in Genome Browser
Species Human (GRCh38)
Location 12:20811504-20811526
Sequence ATGTACCTATGGAACTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093583659_1093583665 8 Left 1093583659 12:20811504-20811526 CCTCCTCAGTTCCATAGGTACAT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1093583665 12:20811535-20811557 CTGGGTCACTTGGCCTGCACTGG 0: 1
1: 0
2: 1
3: 20
4: 182
1093583659_1093583663 -10 Left 1093583659 12:20811504-20811526 CCTCCTCAGTTCCATAGGTACAT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1093583663 12:20811517-20811539 ATAGGTACATGCTAGAAACTGGG 0: 1
1: 0
2: 0
3: 15
4: 191
1093583659_1093583664 -2 Left 1093583659 12:20811504-20811526 CCTCCTCAGTTCCATAGGTACAT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1093583664 12:20811525-20811547 ATGCTAGAAACTGGGTCACTTGG 0: 1
1: 0
2: 1
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093583659 Original CRISPR ATGTACCTATGGAACTGAGG AGG (reversed) Intronic
900567310 1:3339866-3339888 ATCTTCCTATGGGACTGAGCTGG - Intronic
900603848 1:3515219-3515241 GGGCACCTATGGAAGTGAGGTGG + Intronic
904928923 1:34070917-34070939 ATGTAGCTGTGGAACTTTGGAGG + Intronic
906734904 1:48116025-48116047 AAGTACCCATGGAAAAGAGGTGG - Intergenic
911817401 1:102370378-102370400 ATGTACATATAGAATAGAGGGGG + Intergenic
911995813 1:104764945-104764967 AGGGACCTATGGAATTGAAGAGG - Intergenic
915921357 1:159978089-159978111 ATGTTCCTATGGAACTTAATAGG - Intergenic
918720736 1:187849623-187849645 ATATACCCATAAAACTGAGGTGG - Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
922957667 1:229617676-229617698 ATATACCTATGTGTCTGAGGAGG + Intronic
1067807685 10:49404498-49404520 ATGTACCTGGGGACCTGGGGAGG + Intergenic
1072529318 10:96303849-96303871 ATGTACCTATGTAAGTGAACAGG + Intergenic
1073743816 10:106442617-106442639 AAGTAACTTTGGAACTGAGTAGG - Intergenic
1074372373 10:112910477-112910499 ATGGACCTATTGAATAGAGGAGG - Intergenic
1078664032 11:13309775-13309797 CAGTACCCATGGAACTGTGGCGG - Intronic
1079101463 11:17544540-17544562 GTGTGCCTATGGGCCTGAGGTGG + Intergenic
1081549592 11:44098926-44098948 GTGCACCTATGGAACTGGGAAGG + Intronic
1085218030 11:74849355-74849377 ATGTACCTAATGGACTAAGGAGG + Intronic
1093583659 12:20811504-20811526 ATGTACCTATGGAACTGAGGAGG - Intronic
1099671703 12:85702071-85702093 ATGAGCATCTGGAACTGAGGGGG - Intergenic
1101729317 12:107413580-107413602 ATGCCCCCATGGAACTGAGCTGG - Intronic
1105391542 13:19983739-19983761 AGCTACTTATGGGACTGAGGCGG - Intronic
1106356137 13:28985329-28985351 ATGAACCTATGACACTGTGGTGG - Intronic
1114229287 14:20765963-20765985 TTGTTCCTATGGAACTGAACTGG - Intergenic
1114270118 14:21095650-21095672 CTCTATCTATGGTACTGAGGTGG - Intronic
1119045086 14:71311625-71311647 ATATATATATGTAACTGAGGTGG + Intergenic
1124167528 15:27341497-27341519 ATGTACCTACGGAAGTGTGCAGG - Intronic
1125059099 15:35397646-35397668 AGGTACCTCTGGAAGTGAGAGGG + Intronic
1127221516 15:56885906-56885928 ATGTATCTGTGGAACTGATAGGG - Intronic
1128150167 15:65358216-65358238 AGGTACTTAGGGAGCTGAGGTGG - Intronic
1131793255 15:95987843-95987865 AAGTACCTTAGAAACTGAGGGGG + Intergenic
1131795312 15:96010398-96010420 ATGTCCCTCTGGAACTGCAGAGG - Intergenic
1131798030 15:96040221-96040243 ATTTTCCTATGGATCTGGGGTGG - Intergenic
1138826508 16:60327054-60327076 ATGTATTTAAGGAACTGAGGTGG - Intergenic
1141277743 16:82603529-82603551 ATGTTCTTAAGCAACTGAGGGGG + Intergenic
1144689790 17:17253348-17253370 ATGTACTTATGTAACTGAATAGG + Intronic
1147533219 17:41299550-41299572 TTGTACTTCTGGAACTGATGGGG - Intergenic
1148144039 17:45349780-45349802 ATGGACCTTGGGAACTCAGGAGG + Intergenic
1151196090 17:72432075-72432097 ATGTACCTATGGGAGGCAGGTGG - Intergenic
1153612559 18:6901045-6901067 ATGTCCTTCTGGAAATGAGGGGG + Intronic
1157889536 18:51402507-51402529 ATGTAACTATGGAACTCTGTAGG - Intergenic
1159158436 18:64612988-64613010 ATGTATCTATAGACCTAAGGGGG - Intergenic
1161043228 19:2121087-2121109 ATGTACCTGTGGGGCAGAGGCGG + Exonic
1167411596 19:49347350-49347372 AGGTGCCTCTGGTACTGAGGAGG + Exonic
925063553 2:911921-911943 GTGTGTCTGTGGAACTGAGGTGG - Intergenic
926065970 2:9840551-9840573 AGGTACCTAGGAGACTGAGGTGG - Intergenic
928845284 2:35664035-35664057 ATGTAACCATGCAACTGAGGTGG + Intergenic
931183771 2:59929953-59929975 ATGCATCTATGTAACTGAGTTGG + Intergenic
934761675 2:96860115-96860137 ATGTACATATGGAGGTGGGGTGG - Exonic
936438889 2:112533154-112533176 ATATACCTCTGGCACAGAGGAGG + Exonic
937187130 2:120054831-120054853 ATGTATCAATGGAACAGAAGAGG - Intronic
939398909 2:141666464-141666486 ATGTACCTAGGAAGCTGAGGAGG - Intronic
939918029 2:148072607-148072629 ATGTGCCTAAAGAACTGAAGAGG - Intronic
943184589 2:184590981-184591003 ACGTACCTATGCATGTGAGGGGG + Intergenic
943526091 2:189019472-189019494 AGGAAACTCTGGAACTGAGGTGG + Intergenic
944506844 2:200421264-200421286 AAGGACCAATAGAACTGAGGTGG + Intronic
1170214854 20:13880715-13880737 ATGTCCTGATGGAAGTGAGGTGG - Intronic
1172356372 20:34283095-34283117 TTCTACCTCTGGAACTGACGTGG - Intronic
1177270697 21:18845836-18845858 ATGTACCTATGGAATCCAAGAGG + Intergenic
1180655687 22:17418896-17418918 ATGTACCTGTGGAAATGAAGTGG - Intronic
1181290055 22:21784927-21784949 AACTACCTGGGGAACTGAGGAGG - Intronic
1183099755 22:35576643-35576665 AAGTACATGTGGACCTGAGGTGG - Intergenic
1184175187 22:42785044-42785066 AGGTACCTCAGGAATTGAGGGGG + Intergenic
1184771887 22:46602001-46602023 ATGTGTCTATGGAAACGAGGAGG - Intronic
951631989 3:24732025-24732047 ACGTTCCTAAGGCACTGAGGAGG - Intergenic
955092948 3:55770312-55770334 ATGTTCCTATGGTTCTGATGTGG - Intronic
955203918 3:56877977-56877999 ATGTAGCTATGGCTTTGAGGTGG + Intronic
956031346 3:65041053-65041075 GTTTGCCTATGGAAGTGAGGTGG - Intergenic
960073040 3:113453024-113453046 ATTTTCCTATAGAAATGAGGTGG - Intronic
963230445 3:142904334-142904356 ATATACATATATAACTGAGGTGG + Intergenic
963289976 3:143477593-143477615 ATGTAACAATGGAACTGGGTGGG - Intronic
966210318 3:177446412-177446434 ATGTATTTAGGGAACTGAGAGGG + Intergenic
972478998 4:39480215-39480237 ACGTGCCTGTGGCACTGAGGAGG + Intergenic
973047829 4:45556482-45556504 ATGCAACTCTGGAACTGAGATGG + Intergenic
974311533 4:60216937-60216959 ATGTTCCCATGGGACTGAGTGGG - Intergenic
974311976 4:60224235-60224257 ACATACCTGTGGAAATGAGGAGG - Intergenic
976217545 4:82729299-82729321 CTGTACCTATGGTGGTGAGGAGG + Intronic
977546644 4:98389910-98389932 TTGTACCAACAGAACTGAGGGGG + Intronic
983550294 4:169010464-169010486 ATGTACTTGTGGCACTGAGGGGG + Intergenic
984661957 4:182383809-182383831 ATAGACCAATGGAACAGAGGAGG + Intronic
990487856 5:56276895-56276917 ATGTACCTGTGGGACAGAGTAGG + Intergenic
993692317 5:91017379-91017401 ATGTACCAGTGGATCTGTGGGGG + Intronic
995015348 5:107303336-107303358 AGTTGCCTATGGCACTGAGGAGG + Intergenic
995136735 5:108687181-108687203 AGCTACTTGTGGAACTGAGGTGG - Intergenic
995375826 5:111473330-111473352 TTGTGCCTATGGACCTGAGGTGG + Exonic
996221907 5:120943281-120943303 ATGTGGCTATGGAAATGAAGGGG + Intergenic
998445478 5:142195208-142195230 ATGTACCTGTGGTCCTGAGGTGG - Intergenic
1001065338 5:168530865-168530887 ATGTCCCCTTGGAACTGATGGGG + Intergenic
1001279088 5:170373104-170373126 ATGTACTTATGTAAGTGGGGAGG + Intronic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1003735150 6:8869715-8869737 CTGTTCTTATGGAACTGAGCTGG + Intergenic
1004111802 6:12725820-12725842 ATGTCTCTATTGAACTGATGGGG + Intronic
1007591667 6:43024968-43024990 ATGTGCCTGTGGAAGTGGGGAGG - Exonic
1007625951 6:43246590-43246612 ATCTACCTAGGGGAGTGAGGAGG - Exonic
1008667694 6:53732434-53732456 ATGATCCTAGGGAACTGAGAAGG - Intergenic
1010478360 6:76317874-76317896 ATCTACCTATGAGGCTGAGGTGG - Intergenic
1011356875 6:86480316-86480338 AGGTACTTATGGAACTAAGCAGG - Intergenic
1011700135 6:89948317-89948339 AGCTACCTGTGGGACTGAGGTGG - Intronic
1013053093 6:106556110-106556132 ATATCCCTATGGACCTGAGTGGG + Intronic
1016432863 6:144006857-144006879 GTGTATGTATGAAACTGAGGAGG + Intronic
1017510129 6:155106748-155106770 GTGTTCCTATGGAACTTCGGTGG + Intronic
1022879090 7:34567077-34567099 CTGTACCTAATGACCTGAGGTGG - Intergenic
1024408508 7:49011028-49011050 CTGGTCCTATAGAACTGAGGAGG + Intergenic
1026852724 7:73735224-73735246 ATGGACCTATGGAAAGGAAGAGG - Intergenic
1027332041 7:77107343-77107365 ATGGACCACTGGAAATGAGGTGG + Intergenic
1029783734 7:102763982-102764004 ATGGACCACTGGAAATGAGGTGG - Intronic
1033995154 7:147336889-147336911 ATGTCCCTTTGGAATTGAGAGGG - Intronic
1035688461 8:1543516-1543538 ATGGACCCATGGAACTGAACTGG - Intronic
1035961127 8:4139570-4139592 AGCTGCCTATGGAACTGAGTGGG + Intronic
1040687624 8:49894314-49894336 ATGGACTTTTGGAACTCAGGGGG - Intergenic
1042478227 8:69274281-69274303 AGGTGCCTGTGAAACTGAGGTGG + Intergenic
1043636254 8:82387000-82387022 ATGTACCTTAGGACCAGAGGTGG + Intergenic
1046041640 8:108913029-108913051 AAGTACCTTTGCTACTGAGGTGG + Intergenic
1050798230 9:9574269-9574291 ATGTAACTATGGAAATAAGATGG - Intronic
1051775546 9:20629056-20629078 ATGTACCTCTTGAAGTGATGCGG + Intergenic
1055693454 9:78858216-78858238 ATGTGCCTATGGGAATTAGGTGG + Intergenic
1058044040 9:100336702-100336724 ATGTTTCCATGGACCTGAGGTGG - Intronic
1061391486 9:130319525-130319547 ATGTCACTGTGGAACTGGGGAGG + Intronic
1061847833 9:133397849-133397871 CTGAACCTGTGGATCTGAGGAGG + Intronic
1187669453 X:21655244-21655266 ATATAAATATGGAACTGAGAAGG - Exonic
1188728963 X:33622419-33622441 ATCTACCTATCTACCTGAGGAGG + Intergenic
1190029875 X:46961717-46961739 CTGTACTGAGGGAACTGAGGTGG + Intronic
1193958865 X:87899032-87899054 AAGTAGCCATGGAGCTGAGGAGG + Intergenic
1195881920 X:109601450-109601472 AAGTTCACATGGAACTGAGGTGG + Intergenic
1200250985 X:154553616-154553638 AGGTGCCGATGGCACTGAGGTGG - Intronic